Incidental Mutation 'R5931:Trim69'
ID461825
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122178594 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 378 (K378N)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036089
AA Change: K378N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: K378N

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143088
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATTTTCGTACCAGGCCCATC -3'
(R):5'- CGCCCTCATAATCCAGGTAC -3'

Sequencing Primer
(F):5'- AGGCCCATCTCAATTAACTCTGG -3'
(R):5'- TGAGGTCGCCTAGAGTCAGACTAC -3'
Posted On2017-02-28