Incidental Mutation 'R0566:Tnrc6a'
ID46184
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission 038757-MU
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123170913 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 642 (N642I)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]
Predicted Effect probably benign
Transcript: ENSMUST00000094053
AA Change: N642I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: N642I

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205449
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205732
Predicted Effect unknown
Transcript: ENSMUST00000205760
AA Change: N94I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205789
Predicted Effect probably benign
Transcript: ENSMUST00000206014
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211170
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTGTGAATGCAACTCTAATGCAGCC -3'
(R):5'- TGCTTAATAGGAGTCTGTCCCCACC -3'

Sequencing Primer
(F):5'- CTCTAATGCAGCCTGGCATAAATG -3'
(R):5'- TCCCCACCCAGAGTTGGATAG -3'
Posted On2013-06-11