Incidental Mutation 'R0566:Slc35e1'
ID46186
Institutional Source Beutler Lab
Gene Symbol Slc35e1
Ensembl Gene ENSMUSG00000019731
Gene Namesolute carrier family 35, member E1
Synonyms
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R0566 (G1)
Quality Score133
Status Not validated
Chromosome8
Chromosomal Location72480641-72492614 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 72492571 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141352
SMART Domains Protein: ENSMUSP00000122215
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:EamA 5 58 1.5e-6 PFAM
Pfam:UAA 6 214 4e-8 PFAM
Pfam:TPT 67 211 1.7e-38 PFAM
Pfam:EamA 76 211 1.4e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152080
AA Change: T6A
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731
AA Change: T6A

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212699
Meta Mutation Damage Score 0.0528 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 T C 8: 122,781,527 L254P possibly damaging Het
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Slc35e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Slc35e1 APN 8 72483758 utr 3 prime probably benign
IGL01399:Slc35e1 APN 8 72484690 missense probably damaging 1.00
IGL02663:Slc35e1 APN 8 72488209 missense probably damaging 1.00
IGL03349:Slc35e1 APN 8 72483852 missense probably damaging 0.99
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0009:Slc35e1 UTSW 8 72484709 missense probably damaging 1.00
R0054:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0105:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0510:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0511:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0529:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0968:Slc35e1 UTSW 8 72492571 unclassified probably benign
R0969:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1029:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1051:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1123:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1245:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1247:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1314:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1343:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1357:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1401:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1430:Slc35e1 UTSW 8 72492571 unclassified probably benign
R1715:Slc35e1 UTSW 8 72483977 missense probably benign 0.05
R3031:Slc35e1 UTSW 8 72484891 missense probably benign 0.03
R3769:Slc35e1 UTSW 8 72491870 missense possibly damaging 0.89
R4745:Slc35e1 UTSW 8 72492322 missense possibly damaging 0.81
R6884:Slc35e1 UTSW 8 72484882 missense possibly damaging 0.77
R7309:Slc35e1 UTSW 8 72492514 missense unknown
Predicted Primers PCR Primer
(F):5'- ACGGGAAGGCGCTCAAAATCAC -3'
(R):5'- AGGGGAAATTGACACCTACCGCAC -3'

Sequencing Primer
(F):5'- GCGCTCAAAATCACCTTGTTG -3'
(R):5'- GCGTAGTCCAGAGGATTTACC -3'
Posted On2013-06-11