Incidental Mutation 'R5931:Ern1'
ID461860
Institutional Source Beutler Lab
Gene Symbol Ern1
Ensembl Gene ENSMUSG00000020715
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 1
SynonymsIre1a, Ire1alpha, 9030414B18Rik, Ire1p
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106394650-106487852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106426873 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 142 (S142P)
Ref Sequence ENSEMBL: ENSMUSP00000102413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001059] [ENSMUST00000106801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001059
AA Change: S142P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001059
Gene: ENSMUSG00000020715
AA Change: S142P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
low complexity region 471 501 N/A INTRINSIC
low complexity region 513 551 N/A INTRINSIC
Pfam:Pkinase 571 832 1.8e-44 PFAM
Pfam:Pkinase_Tyr 572 829 8.7e-26 PFAM
PUG 895 952 5.25e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106801
AA Change: S142P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102413
Gene: ENSMUSG00000020715
AA Change: S142P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PQQ 28 59 3.46e-5 SMART
PQQ 110 142 1.11e-3 SMART
PQQ 148 180 7.84e-4 SMART
PQQ 191 223 3.26e-1 SMART
PQQ 279 310 5.01e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the ER to nucleus signalling 1 protein, a human homologue of the yeast Ire1 gene product. This protein possesses intrinsic kinase activity and an endoribonuclease activity and it is important in altering gene expression as a response to endoplasmic reticulum-based stress signals. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations display embryonic lethality during organogenesis. Homozygous mice may also display decreased embryo size, impaired hematopoiesis, and/or placental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Eif2b2 C T 12: 85,222,787 T211I probably damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Ern1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ern1 APN 11 106421967 missense probably benign 0.02
IGL01938:Ern1 APN 11 106411657 missense probably benign
IGL02813:Ern1 APN 11 106423425 missense probably damaging 1.00
IGL02928:Ern1 APN 11 106405879 splice site probably benign
IGL02931:Ern1 APN 11 106423440 missense probably damaging 1.00
IGL03153:Ern1 APN 11 106410098 missense possibly damaging 0.63
Immoderate UTSW 11 106420042 missense possibly damaging 0.93
Militant UTSW 11 106411652 missense probably damaging 1.00
K7371:Ern1 UTSW 11 106400275 missense probably damaging 1.00
R0090:Ern1 UTSW 11 106405823 missense probably damaging 1.00
R0391:Ern1 UTSW 11 106407178 nonsense probably null
R0411:Ern1 UTSW 11 106398586 missense probably benign
R0627:Ern1 UTSW 11 106398693 missense probably benign 0.00
R1416:Ern1 UTSW 11 106421980 splice site probably benign
R1831:Ern1 UTSW 11 106399842 splice site probably null
R1837:Ern1 UTSW 11 106458957 missense probably damaging 1.00
R1944:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1945:Ern1 UTSW 11 106421950 missense probably damaging 1.00
R1954:Ern1 UTSW 11 106421974 splice site probably benign
R1957:Ern1 UTSW 11 106426897 missense probably damaging 1.00
R2192:Ern1 UTSW 11 106409924 missense probably benign
R4276:Ern1 UTSW 11 106407181 missense probably benign
R4277:Ern1 UTSW 11 106407181 missense probably benign
R4471:Ern1 UTSW 11 106420042 missense possibly damaging 0.93
R4583:Ern1 UTSW 11 106407205 missense probably damaging 1.00
R4731:Ern1 UTSW 11 106434850 intron probably benign
R5177:Ern1 UTSW 11 106411775 missense probably benign 0.01
R5489:Ern1 UTSW 11 106407529 missense probably damaging 1.00
R5538:Ern1 UTSW 11 106421901 missense possibly damaging 0.83
R5806:Ern1 UTSW 11 106398705 missense probably damaging 0.96
R5922:Ern1 UTSW 11 106421730 missense probably damaging 0.97
R5990:Ern1 UTSW 11 106411769 missense probably benign
R6149:Ern1 UTSW 11 106405815 nonsense probably null
R6253:Ern1 UTSW 11 106426908 missense possibly damaging 0.89
R6721:Ern1 UTSW 11 106411652 missense probably damaging 1.00
R6957:Ern1 UTSW 11 106403539 missense probably damaging 1.00
R7362:Ern1 UTSW 11 106437123 missense probably damaging 1.00
R7387:Ern1 UTSW 11 106421952 missense probably damaging 0.98
X0021:Ern1 UTSW 11 106398606 missense probably damaging 1.00
X0022:Ern1 UTSW 11 106458919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGTCTAGAACTCTGGCTGC -3'
(R):5'- AGCATCTCCAACATCCTGGC -3'

Sequencing Primer
(F):5'- TAGAACTCTGGCTGCCTGGAG -3'
(R):5'- CCAACATCCTGGCATTTCAG -3'
Posted On2017-02-28