Incidental Mutation 'R5931:Eif2b2'
ID461865
Institutional Source Beutler Lab
Gene Symbol Eif2b2
Ensembl Gene ENSMUSG00000004788
Gene Nameeukaryotic translation initiation factor 2B, subunit 2 beta
SynonymsEIF2B, EIF-2Bbeta
MMRRC Submission 044126-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5931 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85219481-85226628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85222787 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 211 (T211I)
Ref Sequence ENSEMBL: ENSMUSP00000122954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004910] [ENSMUST00000136495] [ENSMUST00000140900]
Predicted Effect probably damaging
Transcript: ENSMUST00000004910
AA Change: T214I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004910
Gene: ENSMUSG00000004788
AA Change: T214I

DomainStartEndE-ValueType
Pfam:IF-2B 27 333 3.2e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130760
Predicted Effect probably damaging
Transcript: ENSMUST00000136495
AA Change: T214I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122720
Gene: ENSMUSG00000004788
AA Change: T214I

DomainStartEndE-ValueType
Pfam:IF-2B 27 232 2e-51 PFAM
Pfam:IF-2B 229 287 4.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140900
AA Change: T211I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122954
Gene: ENSMUSG00000004788
AA Change: T211I

DomainStartEndE-ValueType
Pfam:IF-2B 27 228 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of eukaryotic initiation factor-2B (EIF2B). EIF2B is involved in protein synthesis and exchanges GDP and GTP for its activation and deactivation. Mutations in the human gene are associated with ovarioleukodystrophy and leukoencephalopathy with vanishing white matter. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,814,189 T2M probably damaging Het
4930590J08Rik A T 6: 91,919,115 R315W probably damaging Het
Atrn A T 2: 130,933,436 Y153F possibly damaging Het
C4b A G 17: 34,729,193 V1644A probably damaging Het
Carmil3 A C 14: 55,498,940 K654T probably damaging Het
Cdh1 T C 8: 106,666,332 probably null Het
Chrna1 C T 2: 73,568,100 V332M probably benign Het
Clca2 A C 3: 145,092,125 V193G possibly damaging Het
Cyld A G 8: 88,729,842 probably null Het
Dbt A T 3: 116,523,425 E83D possibly damaging Het
Deup1 T C 9: 15,561,322 R471G possibly damaging Het
Dgcr2 T A 16: 17,857,309 I188F possibly damaging Het
Dgkg G A 16: 22,558,038 R524* probably null Het
Dnah5 A T 15: 28,453,279 R4399W probably damaging Het
Egflam G A 15: 7,243,857 T579I possibly damaging Het
Ep400 A G 5: 110,735,520 probably benign Het
Ermp1 C G 19: 29,615,729 A788P probably benign Het
Ern1 A G 11: 106,426,873 S142P possibly damaging Het
Fbxo15 T A 18: 84,981,125 C351S probably damaging Het
Fndc3a A T 14: 72,568,867 S444T probably benign Het
Gabra6 G A 11: 42,307,441 T384M probably benign Het
Gm6169 A G 13: 97,099,197 L14S probably benign Het
Gpbp1l1 T C 4: 116,590,260 V379A probably benign Het
Hook2 G T 8: 84,995,746 E305* probably null Het
Hoxa3 G A 6: 52,172,588 A21V probably damaging Het
Hs1bp3 C A 12: 8,341,915 P339Q probably benign Het
Igha T A 12: 113,260,090 T49S probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Lats2 A G 14: 57,696,131 L843P probably damaging Het
Lcmt1 A G 7: 123,421,616 T255A probably benign Het
Lpar6 A G 14: 73,238,928 I110V probably damaging Het
Lrrtm4 A G 6: 80,021,739 I44V probably damaging Het
Mcm3ap T C 10: 76,471,166 V371A probably benign Het
Muc20 A T 16: 32,794,574 D144E possibly damaging Het
Nphp3 T A 9: 104,020,746 D417E probably damaging Het
Olfr853 A T 9: 19,537,333 I199K probably benign Het
Olfr889 A G 9: 38,116,374 I193V probably benign Het
Paqr7 A C 4: 134,507,720 Y296S probably damaging Het
Pcdha4 A T 18: 36,954,755 T664S probably damaging Het
Pelo T A 13: 115,088,843 Y282F probably benign Het
Plxna2 A T 1: 194,810,870 I1818F probably damaging Het
Pnkd A G 1: 74,350,674 D319G probably benign Het
Pnmal1 C A 7: 16,960,884 N221K probably benign Het
Ppp1cb T A 5: 32,483,466 probably null Het
Prkca T G 11: 108,014,310 I201L probably benign Het
Rfx2 G A 17: 56,780,778 R538C probably damaging Het
Rph3a T C 5: 120,963,873 Q100R probably damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Scel T A 14: 103,605,624 Y547* probably null Het
Sp100 C T 1: 85,679,083 P303L probably damaging Het
Stk31 A G 6: 49,469,302 S958G probably benign Het
Syne2 T A 12: 76,008,865 V4168E probably benign Het
Tenm3 A T 8: 48,646,498 S91T probably benign Het
Tmcc2 TTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGC 1: 132,357,755 probably benign Het
Tmem248 T A 5: 130,229,508 I14N probably damaging Het
Tor3a T C 1: 156,656,487 I298V probably benign Het
Trim69 A T 2: 122,178,594 K378N probably damaging Het
Ttc28 C T 5: 111,085,109 P151S possibly damaging Het
Uaca T C 9: 60,872,012 V1225A probably damaging Het
Vps4b T C 1: 106,777,335 I343V probably benign Het
Wnk4 A G 11: 101,261,221 T184A probably damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Other mutations in Eif2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Eif2b2 APN 12 85219834 missense probably benign 0.00
IGL03156:Eif2b2 APN 12 85219721 missense probably damaging 1.00
IGL03238:Eif2b2 APN 12 85223399 missense probably benign 0.01
R0471:Eif2b2 UTSW 12 85220183 missense probably benign
R0785:Eif2b2 UTSW 12 85221561 missense probably damaging 1.00
R1368:Eif2b2 UTSW 12 85223456 missense probably damaging 0.98
R1442:Eif2b2 UTSW 12 85219586 missense probably benign 0.00
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R3162:Eif2b2 UTSW 12 85219661 missense probably benign
R6954:Eif2b2 UTSW 12 85226043 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTCTTGTAGCTTCCCTGAAG -3'
(R):5'- GCAGATTATAGGGCCTAAGTGC -3'

Sequencing Primer
(F):5'- CCTATGGCTTGCCAGACTGTG -3'
(R):5'- CTCGCTTTCAAATGGTGCTAGAAACC -3'
Posted On2017-02-28