Incidental Mutation 'R0566:Acsf3'
ID46188
Institutional Source Beutler Lab
Gene Symbol Acsf3
Ensembl Gene ENSMUSG00000015016
Gene Nameacyl-CoA synthetase family member 3
Synonyms
MMRRC Submission 038757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0566 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122775486-122817880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122781527 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 254 (L254P)
Ref Sequence ENSEMBL: ENSMUSP00000148762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015160] [ENSMUST00000127664] [ENSMUST00000212781] [ENSMUST00000212790]
Predicted Effect possibly damaging
Transcript: ENSMUST00000015160
AA Change: L254P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015160
Gene: ENSMUSG00000015016
AA Change: L254P

DomainStartEndE-ValueType
Pfam:AMP-binding 47 478 3.9e-86 PFAM
Pfam:AMP-binding_C 486 561 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212781
AA Change: L254P

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212790
AA Change: L254P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212903
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 96% (24/25)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA synthetase family of enzymes that activate fatty acids by catalyzing the formation of a thioester linkage between fatty acids and coenzyme A. The encoded protein is localized to mitochondria, has high specificity for malonate and methylmalonate and possesses malonyl-CoA synthetase activity. Mutations in this gene are a cause of combined malonic and methylmalonic aciduria. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts6 C A 13: 104,444,927 A850E probably benign Het
Ccdc112 A C 18: 46,290,810 V287G probably damaging Het
Ctbp2 A G 7: 132,991,147 V811A probably damaging Het
Dchs1 A G 7: 105,759,195 V1810A probably benign Het
Dhx15 T G 5: 52,171,425 K287T probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fryl T C 5: 73,064,497 probably benign Het
Gnpda2 A G 5: 69,584,961 probably benign Het
Mto1 T C 9: 78,448,301 F2S possibly damaging Het
Nlrp1a A G 11: 71,122,942 L494P probably benign Het
Olfr456 T A 6: 42,487,091 Y34F probably damaging Het
Paqr8 C A 1: 20,935,463 H280Q possibly damaging Het
Perm1 A T 4: 156,217,859 M287L probably benign Het
Piwil2 A G 14: 70,410,394 V323A probably damaging Het
Pon3 A G 6: 5,232,408 V131A possibly damaging Het
Prima1 C A 12: 103,197,314 A133S probably benign Het
Prl7c1 A G 13: 27,778,978 L14P probably damaging Het
Prr23a2 T A 9: 98,856,988 L133H possibly damaging Het
Samd3 T C 10: 26,244,498 V157A possibly damaging Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Tep1 A T 14: 50,845,414 probably null Het
Tmem208 T C 8: 105,334,843 V167A probably benign Het
Tnrc6a A T 7: 123,170,913 N642I probably benign Het
Vps26a A G 10: 62,480,546 probably benign Het
Zfp112 T C 7: 24,125,677 S357P probably benign Het
Other mutations in Acsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsf3 APN 8 122780642 splice site probably benign
IGL01930:Acsf3 APN 8 122780346 missense probably benign 0.03
IGL02064:Acsf3 APN 8 122780247 missense possibly damaging 0.74
IGL02321:Acsf3 APN 8 122780114 missense possibly damaging 0.57
IGL02342:Acsf3 APN 8 122817498 missense probably benign 0.03
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0233:Acsf3 UTSW 8 122780292 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R0240:Acsf3 UTSW 8 122780181 missense probably damaging 1.00
R1255:Acsf3 UTSW 8 122785966 critical splice donor site probably null
R1836:Acsf3 UTSW 8 122780183 missense probably damaging 0.99
R1886:Acsf3 UTSW 8 122784002 missense probably damaging 1.00
R1977:Acsf3 UTSW 8 122781533 missense probably damaging 1.00
R2204:Acsf3 UTSW 8 122813644 missense probably damaging 0.98
R4735:Acsf3 UTSW 8 122781479 missense probably damaging 1.00
R4795:Acsf3 UTSW 8 122780157 missense possibly damaging 0.59
R4850:Acsf3 UTSW 8 122817436 missense probably damaging 1.00
R5092:Acsf3 UTSW 8 122817392 missense probably benign 0.12
R5435:Acsf3 UTSW 8 122780281 missense probably damaging 1.00
R6115:Acsf3 UTSW 8 122790672 missense probably damaging 1.00
R6147:Acsf3 UTSW 8 122781474 missense probably damaging 1.00
R6283:Acsf3 UTSW 8 122785955 missense probably damaging 1.00
R6848:Acsf3 UTSW 8 122790590 missense probably damaging 1.00
R7268:Acsf3 UTSW 8 122790662 missense probably benign 0.16
R7291:Acsf3 UTSW 8 122813577 missense probably benign 0.03
R7319:Acsf3 UTSW 8 122813031 missense probably damaging 1.00
R7350:Acsf3 UTSW 8 122785946 missense probably benign 0.00
R7402:Acsf3 UTSW 8 122780424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTGCCAGTGCCACCCC -3'
(R):5'- AGACCCAGGAGCAGCAGTCA -3'

Sequencing Primer
(F):5'- CATGGGCGTGGACTAAAAAC -3'
(R):5'- ccaggagcaagagccac -3'
Posted On2013-06-11