Incidental Mutation 'R5932:Pdk1'
ID461896
Institutional Source Beutler Lab
Gene Symbol Pdk1
Ensembl Gene ENSMUSG00000006494
Gene Namepyruvate dehydrogenase kinase, isoenzyme 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71873224-71903858 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 71883416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006669]
Predicted Effect probably null
Transcript: ENSMUST00000006669
SMART Domains Protein: ENSMUSP00000006669
Gene: ENSMUSG00000006494

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Pfam:BCDHK_Adom3 56 218 6.4e-52 PFAM
HATPase_c 266 391 1.82e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129887
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156036
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Pdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pdk1 APN 2 71895779 missense probably benign 0.00
IGL01643:Pdk1 APN 2 71897705 missense probably damaging 1.00
IGL02672:Pdk1 APN 2 71895752 missense probably damaging 1.00
IGL02833:Pdk1 APN 2 71897645 critical splice acceptor site probably null
IGL03271:Pdk1 APN 2 71880030 splice site probably benign
IGL03400:Pdk1 APN 2 71895747 missense probably benign 0.25
R0329:Pdk1 UTSW 2 71895674 splice site probably benign
R0564:Pdk1 UTSW 2 71880039 nonsense probably null
R1653:Pdk1 UTSW 2 71888995 critical splice donor site probably null
R2570:Pdk1 UTSW 2 71873560 missense possibly damaging 0.56
R5137:Pdk1 UTSW 2 71883569 missense possibly damaging 0.90
R6109:Pdk1 UTSW 2 71883506 missense probably benign 0.23
R7107:Pdk1 UTSW 2 71895741 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCACAGTAGTATGTAGTGTTACAGG -3'
(R):5'- CTTACAGTGCTGGTTGAGTAGC -3'

Sequencing Primer
(F):5'- AGTAGTATGTAGTGTTACAGGAATCC -3'
(R):5'- GCATTCTAATTGAGATGCGACTC -3'
Posted On2017-02-28