Incidental Mutation 'R5932:Ccdc27'
ID461914
Institutional Source Beutler Lab
Gene Symbol Ccdc27
Ensembl Gene ENSMUSG00000039492
Gene Namecoiled-coil domain containing 27
SynonymsLOC381580
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R5932 (G1)
Quality Score190
Status Not validated
Chromosome4
Chromosomal Location154026639-154042677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154026774 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 627 (V627A)
Ref Sequence ENSEMBL: ENSMUSP00000039642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047207] [ENSMUST00000125533] [ENSMUST00000126119] [ENSMUST00000130175] [ENSMUST00000131325] [ENSMUST00000132541] [ENSMUST00000139569] [ENSMUST00000143047] [ENSMUST00000145527] [ENSMUST00000146054] [ENSMUST00000146426] [ENSMUST00000146543] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect probably benign
Transcript: ENSMUST00000047207
AA Change: V627A

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039642
Gene: ENSMUSG00000039492
AA Change: V627A

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
coiled coil region 203 243 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 329 358 N/A INTRINSIC
coiled coil region 390 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125533
SMART Domains Protein: ENSMUSP00000138324
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126119
SMART Domains Protein: ENSMUSP00000138560
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126624
Predicted Effect probably benign
Transcript: ENSMUST00000130175
SMART Domains Protein: ENSMUSP00000138675
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131325
SMART Domains Protein: ENSMUSP00000138777
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132541
SMART Domains Protein: ENSMUSP00000138471
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139569
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145527
SMART Domains Protein: ENSMUSP00000138448
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146054
SMART Domains Protein: ENSMUSP00000138605
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146426
Predicted Effect probably benign
Transcript: ENSMUST00000146543
SMART Domains Protein: ENSMUSP00000138267
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Ccdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Ccdc27 UTSW 4 154041727 missense unknown
PIT4472001:Ccdc27 UTSW 4 154041727 missense unknown
R0078:Ccdc27 UTSW 4 154035738 splice site probably benign
R0883:Ccdc27 UTSW 4 154036484 missense unknown
R1389:Ccdc27 UTSW 4 154041769 missense unknown
R1773:Ccdc27 UTSW 4 154041765 missense unknown
R1869:Ccdc27 UTSW 4 154026763 unclassified probably null
R2020:Ccdc27 UTSW 4 154033313 missense probably null 0.05
R2070:Ccdc27 UTSW 4 154041813 missense unknown
R2131:Ccdc27 UTSW 4 154036306 small deletion probably benign
R3825:Ccdc27 UTSW 4 154036285 missense unknown
R4183:Ccdc27 UTSW 4 154036306 small deletion probably benign
R4254:Ccdc27 UTSW 4 154039519 missense unknown
R6269:Ccdc27 UTSW 4 154037722 missense unknown
R6324:Ccdc27 UTSW 4 154036191 missense probably benign 0.02
R6761:Ccdc27 UTSW 4 154037698 missense unknown
R7090:Ccdc27 UTSW 4 154028066 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCAGGTGCAGAGAATGAGGTC -3'
(R):5'- ACACACTTCAGAGGCAGAGATC -3'

Sequencing Primer
(F):5'- ATGAGGTCCTGTAGGTACCAG -3'
(R):5'- AGATCTCTGCCTTTGTTTTGATATG -3'
Posted On2017-02-28