Incidental Mutation 'R5932:Usp2'
ID461934
Institutional Source Beutler Lab
Gene Symbol Usp2
Ensembl Gene ENSMUSG00000032010
Gene Nameubiquitin specific peptidase 2
Synonymsubp41, B930035K21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44067021-44095627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44092333 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 481 (I481V)
Ref Sequence ENSEMBL: ENSMUSP00000135018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034508] [ENSMUST00000065379] [ENSMUST00000065461] [ENSMUST00000114830] [ENSMUST00000162126] [ENSMUST00000175816] [ENSMUST00000176416] [ENSMUST00000177054] [ENSMUST00000185479]
Predicted Effect probably benign
Transcript: ENSMUST00000034508
AA Change: I481V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034508
Gene: ENSMUSG00000032010
AA Change: I481V

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 8.4e-75 PFAM
Pfam:UCH_1 281 592 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065461
AA Change: I258V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070264
Gene: ENSMUSG00000032010
AA Change: I258V

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 57 387 7.5e-79 PFAM
Pfam:UCH_1 58 369 2.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114830
AA Change: I481V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110479
Gene: ENSMUSG00000032010
AA Change: I481V

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162196
Predicted Effect probably benign
Transcript: ENSMUST00000175816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176022
Predicted Effect probably benign
Transcript: ENSMUST00000176416
AA Change: I255V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135482
Gene: ENSMUSG00000032010
AA Change: I255V

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 54 384 7.3e-79 PFAM
Pfam:UCH_1 55 366 2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177054
AA Change: I481V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135018
Gene: ENSMUSG00000032010
AA Change: I481V

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177422
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null mutation display severely reduced male fertility with defects in sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,244,595 probably null Het
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in Usp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Usp2 APN 9 44089165 nonsense probably null
IGL01574:Usp2 APN 9 44093803 missense probably damaging 1.00
IGL02103:Usp2 APN 9 44089128 intron probably benign
IGL02391:Usp2 APN 9 44091227 missense probably damaging 1.00
R0385:Usp2 UTSW 9 44092750 missense probably damaging 0.99
R0555:Usp2 UTSW 9 44092784 missense probably damaging 1.00
R0614:Usp2 UTSW 9 44092492 nonsense probably null
R1553:Usp2 UTSW 9 44092155 missense probably damaging 0.99
R1851:Usp2 UTSW 9 44075966 missense probably benign 0.00
R2437:Usp2 UTSW 9 44092148 missense probably damaging 0.98
R3962:Usp2 UTSW 9 44075657 missense possibly damaging 0.82
R4392:Usp2 UTSW 9 44091259 missense probably damaging 1.00
R4411:Usp2 UTSW 9 44091063 missense probably damaging 1.00
R4894:Usp2 UTSW 9 44075828 missense probably benign 0.03
R4960:Usp2 UTSW 9 44075813 missense probably damaging 1.00
R5482:Usp2 UTSW 9 44089183 critical splice donor site probably null
R5496:Usp2 UTSW 9 44085208 missense possibly damaging 0.95
R6956:Usp2 UTSW 9 44092756 missense probably damaging 1.00
R7007:Usp2 UTSW 9 44090042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGAGCTCCCTCACATGC -3'
(R):5'- ATCGTTTTCTGGCTCGGCAG -3'

Sequencing Primer
(F):5'- ACATGCACCGATTGTGGCTAC -3'
(R):5'- GCGGCAGCAAGTCTAAAAGAC -3'
Posted On2017-02-28