Incidental Mutation 'R5932:2410089E03Rik'
ID461956
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene NameRIKEN cDNA 2410089E03 gene
Synonymsb2b012Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5932 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location8169106-8271158 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 8244595 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
Predicted Effect probably null
Transcript: ENSMUST00000110617
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128772
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T A 19: 31,893,118 S7T possibly damaging Het
A530099J19Rik C A 13: 19,729,476 noncoding transcript Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Akap1 A G 11: 88,831,759 L890P probably damaging Het
Akap13 T A 7: 75,610,184 M49K probably damaging Het
Ankrd17 A T 5: 90,265,436 N1206K probably damaging Het
Bbs7 G A 3: 36,582,698 T480I probably benign Het
Bbs9 A G 9: 22,812,331 E769G probably damaging Het
BC027072 T C 17: 71,751,753 R310G probably damaging Het
Bpgm T A 6: 34,487,925 S192R probably damaging Het
Brinp1 C A 4: 68,792,941 K343N probably benign Het
Cabyr T G 18: 12,754,350 V185G probably damaging Het
Cadm1 C A 9: 47,799,451 D217E probably damaging Het
Camk1g T A 1: 193,354,039 E171V probably benign Het
Casz1 T A 4: 148,939,113 M825K possibly damaging Het
Ccdc27 A G 4: 154,026,774 V627A probably benign Het
Ccdc40 T G 11: 119,251,012 I808R probably damaging Het
Cdh23 G A 10: 60,392,984 R1140C probably damaging Het
Celsr1 A G 15: 86,032,704 V356A probably damaging Het
Cep126 T A 9: 8,103,508 D167V probably damaging Het
Chmp4b C T 2: 154,691,281 T147I probably benign Het
Clstn3 A T 6: 124,438,332 M728K probably benign Het
Col7a1 A T 9: 108,980,211 E2618V unknown Het
Crls1 T A 2: 132,864,167 Y170* probably null Het
Epas1 T G 17: 86,827,646 I569S possibly damaging Het
Fhl3 T C 4: 124,705,727 Y32H probably damaging Het
Fibp G A 19: 5,464,425 G333D probably benign Het
Frmd4a C T 2: 4,529,839 T156I probably damaging Het
Gcn1l1 T C 5: 115,592,376 L873P possibly damaging Het
Hectd3 G A 4: 117,002,273 R698H possibly damaging Het
Il17a T C 1: 20,733,753 V124A probably damaging Het
Kif14 A T 1: 136,516,390 E1373D probably benign Het
Klra4 C T 6: 130,053,053 V190M possibly damaging Het
Kmt2a T C 9: 44,820,647 probably benign Het
L3mbtl1 GGCCG GG 2: 162,967,336 probably benign Het
Lamb2 T C 9: 108,480,611 I111T probably damaging Het
Lrch3 A T 16: 32,975,736 D204V probably damaging Het
Mansc1 C A 6: 134,610,515 R233L possibly damaging Het
Mkrn3 A G 7: 62,418,907 C379R probably damaging Het
Ncoa3 T A 2: 166,070,125 probably null Het
Neu3 A T 7: 99,813,318 C399* probably null Het
Olfr287 T G 15: 98,207,415 *323S probably null Het
Olfr671 G A 7: 104,975,655 T114M probably damaging Het
Pde5a T C 3: 122,841,044 F713L probably benign Het
Pdk1 T A 2: 71,883,416 probably null Het
Plin4 A G 17: 56,106,356 V423A possibly damaging Het
Pstpip1 T A 9: 56,125,930 Y249N probably damaging Het
Ptprf A T 4: 118,211,767 C1673S probably benign Het
Pum1 A G 4: 130,730,366 T230A probably benign Het
Qsox1 A T 1: 155,789,333 D287E probably benign Het
Rad51ap2 A G 12: 11,458,386 N770D probably damaging Het
Rtp3 T A 9: 110,986,692 I202F probably benign Het
Slc26a4 C T 12: 31,535,249 probably null Het
Spata48 A G 11: 11,488,513 probably benign Het
Sptbn1 C G 11: 30,136,136 V1191L probably damaging Het
St5 G A 7: 109,570,016 T24M probably damaging Het
Tead2 T C 7: 45,232,899 Y121H probably benign Het
Thsd7b T C 1: 129,430,838 L3P probably benign Het
Trim24 T C 6: 37,957,075 I651T probably damaging Het
Usp2 A G 9: 44,092,333 I481V probably benign Het
Vps13d C A 4: 145,045,041 V4056F possibly damaging Het
Yeats2 A G 16: 20,193,163 E496G probably benign Het
Zap70 A G 1: 36,781,146 K503E probably damaging Het
Zbtb46 A G 2: 181,411,920 L333P probably benign Het
Zfc3h1 A T 10: 115,400,910 T430S probably benign Het
Zfp618 C T 4: 63,118,566 R368* probably null Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4659:2410089E03Rik UTSW 15 8216276 intron probably benign
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTTCCATTGTCGATGCCG -3'
(R):5'- TACTAAGGGTGCCAGGCTTG -3'

Sequencing Primer
(F):5'- CTCCTCATACTTTTCAAAGTCAAGG -3'
(R):5'- GCTTTTGCAAAGATCAAGTAGCAAC -3'
Posted On2017-02-28