Incidental Mutation 'R5933:Fry'
ID462008
Institutional Source Beutler Lab
Gene Symbol Fry
Ensembl Gene ENSMUSG00000056602
Gene NameFRY microtubule binding protein
Synonyms9330186A19Rik, cg003
MMRRC Submission 044127-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R5933 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150118645-150497753 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 150390800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000084454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087204]
Predicted Effect probably benign
Transcript: ENSMUST00000087204
SMART Domains Protein: ENSMUSP00000084454
Gene: ENSMUSG00000056602

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 165 697 5.3e-170 PFAM
low complexity region 1014 1040 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1188 1380 1.2e-15 PFAM
Pfam:MOR2-PAG1_mid 1398 1534 1.5e-5 PFAM
Pfam:MOR2-PAG1_mid 1632 1704 1.8e-7 PFAM
Pfam:MOR2-PAG1_mid 1772 1906 4.9e-10 PFAM
low complexity region 1936 1956 N/A INTRINSIC
low complexity region 1962 1980 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2050 2303 1.9e-74 PFAM
low complexity region 2369 2385 N/A INTRINSIC
low complexity region 2463 2482 N/A INTRINSIC
low complexity region 2525 2534 N/A INTRINSIC
low complexity region 2836 2852 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202841
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 94% (99/105)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,070,348 P1766L probably damaging Het
Abca13 A G 11: 9,249,658 Q119R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aipl1 A C 11: 72,030,282 C237G probably benign Het
Ankdd1a C T 9: 65,509,696 A154T probably benign Het
Arglu1 T C 8: 8,690,047 S91G probably benign Het
Arhgef33 C A 17: 80,337,280 H13N probably benign Het
Atp1a4 A G 1: 172,232,274 I796T possibly damaging Het
Birc6 C G 17: 74,599,237 S1374R probably damaging Het
Birc6 T A 17: 74,599,238 S72T probably damaging Het
Bmpr1b T C 3: 141,871,367 *59W probably null Het
Btbd16 A T 7: 130,784,281 Q63L probably damaging Het
Cacna1c C T 6: 118,612,580 R1592H probably damaging Het
Caps2 G A 10: 112,215,446 E541K probably benign Het
Card9 T C 2: 26,352,497 E500G probably damaging Het
Carnmt1 T C 19: 18,704,105 V396A probably benign Het
Ccnl1 T A 3: 65,948,342 K320M probably damaging Het
Cdh20 A C 1: 104,984,671 D550A probably damaging Het
Cdhr1 T A 14: 37,089,462 T231S probably benign Het
Cenpe T C 3: 135,261,628 V2177A probably benign Het
Cfap69 A G 5: 5,640,183 C161R probably damaging Het
Ctsd C T 7: 142,376,579 V403I probably benign Het
Cyth1 C T 11: 118,185,759 probably null Het
Dazl A T 17: 50,287,753 probably null Het
Disp3 A T 4: 148,241,313 C1329* probably null Het
Dld C T 12: 31,333,983 V374I probably benign Het
Dnah7c T C 1: 46,519,215 Y494H probably damaging Het
Dnttip2 T A 3: 122,275,568 M144K probably benign Het
Drc1 A T 5: 30,345,529 D132V probably damaging Het
Enpp6 A G 8: 47,066,004 D269G probably benign Het
Ephx4 T A 5: 107,403,765 probably null Het
Evl T C 12: 108,683,257 S345P possibly damaging Het
Fam193a A T 5: 34,465,680 D1204V probably damaging Het
Fat2 A T 11: 55,284,051 D1945E probably damaging Het
Fat4 T C 3: 38,951,375 probably null Het
Fbln7 A T 2: 128,877,498 M72L probably benign Het
Flnc T C 6: 29,441,106 V353A probably damaging Het
Galnt14 A T 17: 73,526,305 C225S probably benign Het
Gapvd1 T C 2: 34,684,291 S1265G probably benign Het
Gm13030 A G 4: 138,871,204 F136S unknown Het
Gucy1a1 T C 3: 82,094,807 H655R probably damaging Het
Hk1 A G 10: 62,269,994 L890P probably damaging Het
Igfn1 T A 1: 135,970,603 R742* probably null Het
Igkv12-49 T C 6: 69,716,569 noncoding transcript Het
Igkv2-109 T A 6: 68,302,981 L62Q possibly damaging Het
Itgb3 A G 11: 104,637,979 T311A possibly damaging Het
Kl A G 5: 150,989,483 E899G probably damaging Het
Kyat3 A T 3: 142,723,260 D151V probably damaging Het
Morc2b A T 17: 33,138,609 M63K possibly damaging Het
Mtbp T A 15: 55,571,327 F298L possibly damaging Het
Mtmr3 C T 11: 4,498,951 V272I probably benign Het
Muc4 A G 16: 32,753,052 T977A probably benign Het
Nebl G A 2: 17,404,187 H367Y probably benign Het
Nop58 T A 1: 59,704,665 Y274* probably null Het
Nuak1 T A 10: 84,374,802 Q474L probably damaging Het
Obscn A G 11: 58,998,505 S7523P unknown Het
Olfr625-ps1 T A 7: 103,683,473 C242S probably damaging Het
Oosp3 T A 19: 11,705,389 D140E probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Patl1 A G 19: 11,939,772 N661S probably benign Het
Pcyox1l G T 18: 61,698,473 N238K probably benign Het
Pmch A G 10: 88,091,149 T5A probably benign Het
Polr3h A G 15: 81,916,634 L169P probably damaging Het
Ptpn4 A G 1: 119,687,723 V567A probably damaging Het
Rasgrp2 T G 19: 6,402,513 F39V probably damaging Het
Setd1b G A 5: 123,158,752 probably benign Het
Sh3glb2 A T 2: 30,350,389 probably null Het
Slc46a3 A T 5: 147,893,890 N44K probably benign Het
Slc9b1 T A 3: 135,393,995 N425K probably benign Het
Slfn14 A T 11: 83,279,462 V452E probably damaging Het
Slfn8 A T 11: 83,003,335 M826K probably benign Het
Slit3 G A 11: 35,629,751 V572M probably benign Het
Smr3a C A 5: 88,008,014 probably null Het
Snap29 T C 16: 17,406,330 S70P probably damaging Het
Svopl T A 6: 38,017,014 probably benign Het
Tbc1d17 A T 7: 44,845,337 F186I probably damaging Het
Tgm6 T C 2: 130,141,256 V255A probably damaging Het
Tjp1 G T 7: 65,302,852 T1498K probably benign Het
Tkfc C A 19: 10,597,347 E176D probably benign Het
Tmem102 C T 11: 69,803,680 V489I probably damaging Het
Ttn A G 2: 76,721,437 V22930A probably damaging Het
Tyms A T 5: 30,073,359 probably null Het
Uaca T A 9: 60,840,956 D67E probably damaging Het
Unc119b G A 5: 115,127,449 probably benign Het
Usp29 A T 7: 6,961,745 T196S probably benign Het
Usp37 A G 1: 74,485,982 S228P probably damaging Het
Usp42 C A 5: 143,715,515 A918S probably benign Het
Vmn2r72 T A 7: 85,737,850 L835F probably benign Het
Vps13a T C 19: 16,660,530 T2396A probably benign Het
Whrn A T 4: 63,494,708 S176T probably damaging Het
Zbtb42 T C 12: 112,680,621 F410S probably damaging Het
Zfp616 T C 11: 74,083,126 S74P probably damaging Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Fry
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Fry APN 5 150340404 nonsense probably null
IGL00328:Fry APN 5 150340404 nonsense probably null
IGL00841:Fry APN 5 150422724 missense probably benign
IGL00938:Fry APN 5 150370180 missense probably damaging 1.00
IGL01015:Fry APN 5 150422787 missense probably benign 0.18
IGL01401:Fry APN 5 150438788 missense probably benign
IGL01616:Fry APN 5 150399599 missense probably damaging 1.00
IGL01616:Fry APN 5 150438811 splice site probably null
IGL01748:Fry APN 5 150345651 splice site probably benign
IGL01965:Fry APN 5 150381621 missense probably damaging 1.00
IGL02030:Fry APN 5 150471618 splice site probably benign
IGL02079:Fry APN 5 150399624 missense probably damaging 0.97
IGL02087:Fry APN 5 150403594 missense probably benign 0.23
IGL02113:Fry APN 5 150399605 missense probably benign
IGL02209:Fry APN 5 150437026 missense probably benign 0.00
IGL02250:Fry APN 5 150403434 splice site probably benign
IGL02265:Fry APN 5 150437153 missense probably damaging 1.00
IGL02486:Fry APN 5 150491177 missense probably damaging 0.99
IGL02552:Fry APN 5 150380910 missense probably damaging 1.00
IGL02881:Fry APN 5 150359051 missense probably damaging 0.99
IGL03008:Fry APN 5 150345556 missense possibly damaging 0.82
IGL03140:Fry APN 5 150495701 missense probably damaging 0.98
IGL03171:Fry APN 5 150380809 missense probably damaging 1.00
IGL03389:Fry APN 5 150394231 missense probably damaging 1.00
IGL03404:Fry APN 5 150326168 missense probably damaging 1.00
R0023:Fry UTSW 5 150451098 missense possibly damaging 0.78
R0024:Fry UTSW 5 150380803 missense probably benign 0.03
R0030:Fry UTSW 5 150372569 nonsense probably null
R0053:Fry UTSW 5 150461377 splice site probably benign
R0089:Fry UTSW 5 150340427 missense possibly damaging 0.91
R0212:Fry UTSW 5 150496397 missense probably damaging 0.99
R0241:Fry UTSW 5 150260346 intron probably benign
R0265:Fry UTSW 5 150434776 missense probably damaging 1.00
R0317:Fry UTSW 5 150471468 missense probably damaging 1.00
R0532:Fry UTSW 5 150433707 unclassified probably benign
R0532:Fry UTSW 5 150478761 splice site probably benign
R0599:Fry UTSW 5 150437159 missense probably damaging 0.99
R0631:Fry UTSW 5 150496352 missense possibly damaging 0.82
R0723:Fry UTSW 5 150496360 missense probably damaging 1.00
R0766:Fry UTSW 5 150403432 splice site probably benign
R0790:Fry UTSW 5 150466437 missense probably benign 0.06
R0928:Fry UTSW 5 150437084 missense probably damaging 1.00
R1104:Fry UTSW 5 150496289 missense probably damaging 1.00
R1144:Fry UTSW 5 150418464 missense possibly damaging 0.94
R1172:Fry UTSW 5 150481494 nonsense probably null
R1312:Fry UTSW 5 150403432 splice site probably benign
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1347:Fry UTSW 5 150495818 missense probably damaging 1.00
R1437:Fry UTSW 5 150310425 missense possibly damaging 0.92
R1458:Fry UTSW 5 150380859 missense probably damaging 1.00
R1542:Fry UTSW 5 150404966 missense probably benign 0.13
R1692:Fry UTSW 5 150370227 missense probably damaging 1.00
R1826:Fry UTSW 5 150436709 missense possibly damaging 0.82
R1874:Fry UTSW 5 150345921 missense probably damaging 1.00
R1875:Fry UTSW 5 150326132 missense probably damaging 1.00
R1881:Fry UTSW 5 150478046 missense probably damaging 0.97
R1884:Fry UTSW 5 150403520 missense probably benign 0.00
R1929:Fry UTSW 5 150400924 missense probably null 0.02
R2066:Fry UTSW 5 150370119 splice site probably benign
R2270:Fry UTSW 5 150400924 missense probably null 0.02
R2356:Fry UTSW 5 150471432 missense probably benign
R3720:Fry UTSW 5 150454572 missense probably damaging 1.00
R3773:Fry UTSW 5 150398198 missense probably damaging 0.96
R3824:Fry UTSW 5 150496419 missense possibly damaging 0.94
R3902:Fry UTSW 5 150345927 missense probably damaging 1.00
R3923:Fry UTSW 5 150413349 missense probably benign
R4250:Fry UTSW 5 150310360 missense probably damaging 0.99
R4332:Fry UTSW 5 150381663 missense probably damaging 1.00
R4495:Fry UTSW 5 150310463 missense probably damaging 1.00
R4610:Fry UTSW 5 150386104 missense probably damaging 1.00
R4682:Fry UTSW 5 150422754 missense probably damaging 1.00
R4732:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4733:Fry UTSW 5 150386007 missense possibly damaging 0.93
R4755:Fry UTSW 5 150398254 missense probably damaging 0.99
R4788:Fry UTSW 5 150399636 missense probably benign 0.00
R4803:Fry UTSW 5 150399533 missense probably benign 0.31
R4858:Fry UTSW 5 150401643 missense possibly damaging 0.78
R4872:Fry UTSW 5 150394239 critical splice donor site probably null
R4902:Fry UTSW 5 150495703 missense probably benign 0.43
R4915:Fry UTSW 5 150478863 missense probably benign 0.30
R4938:Fry UTSW 5 150477989 missense probably damaging 1.00
R4983:Fry UTSW 5 150398254 missense probably damaging 1.00
R5004:Fry UTSW 5 150433604 missense probably benign 0.16
R5040:Fry UTSW 5 150388854 missense probably damaging 0.99
R5145:Fry UTSW 5 150370224 missense probably damaging 0.98
R5170:Fry UTSW 5 150429854 missense probably benign 0.03
R5233:Fry UTSW 5 150469720 missense possibly damaging 0.71
R5428:Fry UTSW 5 150405359 missense possibly damaging 0.89
R5468:Fry UTSW 5 150399588 missense probably benign 0.44
R5481:Fry UTSW 5 150260319 missense probably benign 0.01
R5494:Fry UTSW 5 150390667 missense probably damaging 1.00
R5538:Fry UTSW 5 150495848 missense probably damaging 1.00
R5638:Fry UTSW 5 150359081 missense possibly damaging 0.46
R5645:Fry UTSW 5 150380867 missense probably damaging 1.00
R5716:Fry UTSW 5 150370221 nonsense probably null
R5812:Fry UTSW 5 150399671 missense probably damaging 0.99
R5813:Fry UTSW 5 150399671 missense probably damaging 0.99
R5873:Fry UTSW 5 150378885 missense probably damaging 1.00
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6037:Fry UTSW 5 150428179 missense probably benign 0.03
R6158:Fry UTSW 5 150454572 missense probably damaging 1.00
R6178:Fry UTSW 5 150454522 missense probably damaging 1.00
R6481:Fry UTSW 5 150386014 missense probably damaging 1.00
R6562:Fry UTSW 5 150326149 missense probably damaging 1.00
R6676:Fry UTSW 5 150380922 missense probably benign 0.22
R6717:Fry UTSW 5 150496312 missense probably benign 0.00
R6828:Fry UTSW 5 150466446 splice site probably null
R6874:Fry UTSW 5 150437303 missense probably benign 0.00
R6930:Fry UTSW 5 150428230 missense probably benign 0.00
R6963:Fry UTSW 5 150457844 missense probably benign 0.17
R6965:Fry UTSW 5 150416220 missense possibly damaging 0.79
R7051:Fry UTSW 5 150395169 missense possibly damaging 0.93
R7085:Fry UTSW 5 150438749 missense probably benign 0.02
R7108:Fry UTSW 5 150395786 missense probably damaging 1.00
R7108:Fry UTSW 5 150491090 missense
R7115:Fry UTSW 5 150386067 missense probably damaging 1.00
R7116:Fry UTSW 5 150395869 critical splice donor site probably null
R7197:Fry UTSW 5 150469767 missense
R7256:Fry UTSW 5 150466786 missense
R7318:Fry UTSW 5 150436993 missense probably damaging 0.98
R7323:Fry UTSW 5 150496349 missense
R7358:Fry UTSW 5 150416323 missense probably benign
R7361:Fry UTSW 5 150436847 missense possibly damaging 0.92
R7395:Fry UTSW 5 150380883 missense possibly damaging 0.82
R7487:Fry UTSW 5 150414574 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGTACAGGACGATGACAGGC -3'
(R):5'- GTGGAACTTATGTATTGAGACTGC -3'

Sequencing Primer
(F):5'- CAGGCCAATGATTGATGTCATGGATC -3'
(R):5'- AGACCTGTCCTGTGCTA -3'
Posted On2017-02-28