Incidental Mutation 'R5934:Pard3'
ID462109
Institutional Source Beutler Lab
Gene Symbol Pard3
Ensembl Gene ENSMUSG00000025812
Gene Namepar-3 family cell polarity regulator
SynonymsASIP, PAR-3, Pard3a, Par3, D8Ertd580e
MMRRC Submission 044128-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5934 (G1)
Quality Score185
Status Not validated
Chromosome8
Chromosomal Location127063893-127612286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127389338 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 636 (L636R)
Ref Sequence ENSEMBL: ENSMUSP00000124319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026921] [ENSMUST00000079777] [ENSMUST00000108752] [ENSMUST00000159537] [ENSMUST00000160272] [ENSMUST00000160581] [ENSMUST00000160717] [ENSMUST00000160766] [ENSMUST00000161355] [ENSMUST00000162176] [ENSMUST00000162309] [ENSMUST00000162456] [ENSMUST00000162531] [ENSMUST00000162536] [ENSMUST00000162602] [ENSMUST00000162907]
Predicted Effect probably damaging
Transcript: ENSMUST00000026921
AA Change: L636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026921
Gene: ENSMUSG00000025812
AA Change: L636R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.1e-72 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 3e-10 PDB
low complexity region 863 875 N/A INTRINSIC
low complexity region 892 902 N/A INTRINSIC
low complexity region 921 950 N/A INTRINSIC
low complexity region 965 1005 N/A INTRINSIC
low complexity region 1162 1200 N/A INTRINSIC
low complexity region 1264 1281 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079777
AA Change: L501R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078710
Gene: ENSMUSG00000025812
AA Change: L501R

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108752
AA Change: L501R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104383
Gene: ENSMUSG00000025812
AA Change: L501R

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159537
AA Change: L579R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124934
Gene: ENSMUSG00000025812
AA Change: L579R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.7e-73 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 717 727 N/A INTRINSIC
PDB:4DC2|Z 756 783 2e-10 PDB
low complexity region 823 835 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
low complexity region 881 910 N/A INTRINSIC
low complexity region 925 943 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160272
AA Change: L636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125453
Gene: ENSMUSG00000025812
AA Change: L636R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1.7e-60 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 878 890 N/A INTRINSIC
low complexity region 907 917 N/A INTRINSIC
low complexity region 936 965 N/A INTRINSIC
low complexity region 980 1020 N/A INTRINSIC
low complexity region 1177 1215 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160581
AA Change: L626R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124141
Gene: ENSMUSG00000025812
AA Change: L626R

DomainStartEndE-ValueType
Pfam:DUF3534 4 149 7.1e-73 PFAM
low complexity region 237 249 N/A INTRINSIC
PDZ 285 364 2.34e-6 SMART
low complexity region 434 443 N/A INTRINSIC
PDZ 472 551 4.1e-20 SMART
PDZ 589 674 9.87e-14 SMART
low complexity region 764 774 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
low complexity region 870 880 N/A INTRINSIC
low complexity region 899 928 N/A INTRINSIC
low complexity region 943 983 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160593
Predicted Effect probably damaging
Transcript: ENSMUST00000160717
AA Change: L501R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125612
Gene: ENSMUSG00000025812
AA Change: L501R

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160766
AA Change: L579R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124533
Gene: ENSMUSG00000025812
AA Change: L579R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 542 627 9.87e-14 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
low complexity region 820 830 N/A INTRINSIC
low complexity region 849 878 N/A INTRINSIC
low complexity region 893 933 N/A INTRINSIC
low complexity region 1090 1128 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161277
AA Change: L554R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124789
Gene: ENSMUSG00000025812
AA Change: L554R

DomainStartEndE-ValueType
Pfam:DUF3534 3 122 9.6e-37 PFAM
PDZ 214 293 2.34e-6 SMART
low complexity region 363 372 N/A INTRINSIC
PDZ 401 480 4.1e-20 SMART
PDZ 518 603 9.87e-14 SMART
low complexity region 693 703 N/A INTRINSIC
PDB:4DC2|Z 732 759 2e-10 PDB
low complexity region 799 811 N/A INTRINSIC
low complexity region 828 838 N/A INTRINSIC
low complexity region 857 886 N/A INTRINSIC
low complexity region 901 919 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161355
AA Change: L636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125064
Gene: ENSMUSG00000025812
AA Change: L636R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 886 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 949 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162176
AA Change: L358R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123944
Gene: ENSMUSG00000025812
AA Change: L358R

DomainStartEndE-ValueType
PDZ 1 83 4.11e-2 SMART
low complexity region 153 162 N/A INTRINSIC
PDZ 191 270 4.1e-20 SMART
PDZ 321 406 9.87e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162309
AA Change: L636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124282
Gene: ENSMUSG00000025812
AA Change: L636R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 6.2e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 771 781 N/A INTRINSIC
PDB:4DC2|Z 810 837 4e-10 PDB
low complexity region 877 889 N/A INTRINSIC
low complexity region 906 916 N/A INTRINSIC
low complexity region 935 964 N/A INTRINSIC
low complexity region 979 1019 N/A INTRINSIC
low complexity region 1176 1214 N/A INTRINSIC
low complexity region 1278 1295 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162456
AA Change: L501R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124162
Gene: ENSMUSG00000025812
AA Change: L501R

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
PDZ 147 226 2.34e-6 SMART
low complexity region 296 305 N/A INTRINSIC
PDZ 334 413 4.1e-20 SMART
PDZ 464 549 9.87e-14 SMART
low complexity region 636 646 N/A INTRINSIC
PDB:4DC2|Z 675 702 2e-10 PDB
low complexity region 743 755 N/A INTRINSIC
low complexity region 772 782 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
low complexity region 845 885 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162531
AA Change: L623R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125610
Gene: ENSMUSG00000025812
AA Change: L623R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 8.4e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 586 671 9.87e-14 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 838 850 N/A INTRINSIC
low complexity region 867 877 N/A INTRINSIC
low complexity region 896 925 N/A INTRINSIC
low complexity region 940 980 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162536
AA Change: L592R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125212
Gene: ENSMUSG00000025812
AA Change: L592R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 1e-72 PFAM
PDZ 238 317 2.34e-6 SMART
low complexity region 387 396 N/A INTRINSIC
PDZ 425 504 4.1e-20 SMART
PDZ 555 640 9.87e-14 SMART
low complexity region 727 737 N/A INTRINSIC
PDB:4DC2|Z 766 793 3e-10 PDB
low complexity region 833 845 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
low complexity region 891 920 N/A INTRINSIC
low complexity region 935 975 N/A INTRINSIC
low complexity region 1132 1170 N/A INTRINSIC
low complexity region 1234 1251 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162602
AA Change: L636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125450
Gene: ENSMUSG00000025812
AA Change: L636R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 7.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
low complexity region 774 784 N/A INTRINSIC
PDB:4DC2|Z 813 840 2e-10 PDB
low complexity region 881 893 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 939 968 N/A INTRINSIC
low complexity region 983 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162665
AA Change: L655R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124718
Gene: ENSMUSG00000025812
AA Change: L655R

DomainStartEndE-ValueType
Pfam:DUF3534 21 166 1.4e-60 PFAM
low complexity region 254 266 N/A INTRINSIC
PDZ 302 381 2.34e-6 SMART
low complexity region 451 460 N/A INTRINSIC
PDZ 489 568 4.1e-20 SMART
PDZ 619 704 9.87e-14 SMART
low complexity region 791 801 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 926 955 N/A INTRINSIC
low complexity region 970 1010 N/A INTRINSIC
low complexity region 1167 1205 N/A INTRINSIC
low complexity region 1269 1286 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162727
AA Change: L7R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124359
Gene: ENSMUSG00000025812
AA Change: L7R

DomainStartEndE-ValueType
Blast:PDZ 2 56 8e-30 BLAST
PDB:2KOH|A 2 61 4e-35 PDB
SCOP:d1qaua_ 4 55 3e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162907
AA Change: L636R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124319
Gene: ENSMUSG00000025812
AA Change: L636R

DomainStartEndE-ValueType
Pfam:DUF3534 1 146 4.6e-73 PFAM
low complexity region 234 246 N/A INTRINSIC
PDZ 282 361 2.34e-6 SMART
low complexity region 431 440 N/A INTRINSIC
PDZ 469 548 4.1e-20 SMART
PDZ 599 684 9.87e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality at E12.5 associated with growth retardation, abnormal heart development, and abnormal epicardial cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T C 5: 8,930,806 V596A probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg1l G A 10: 42,318,686 T370M probably damaging Het
Aldh2 T C 5: 121,579,615 T118A probably benign Het
Apcdd1 C T 18: 62,951,869 A379V possibly damaging Het
Atp1a3 T C 7: 24,978,874 probably benign Het
Cd96 G T 16: 46,117,903 D66E probably benign Het
Cdh5 T A 8: 104,138,268 V506E probably benign Het
Cep70 T C 9: 99,254,265 I7T probably benign Het
Ckb A T 12: 111,670,229 V237D probably damaging Het
Col6a6 C T 9: 105,767,075 D1306N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
D1Ertd622e A T 1: 97,645,930 C137S possibly damaging Het
Ddhd2 A G 8: 25,753,113 S19P probably damaging Het
Dnah17 G T 11: 118,041,102 D3681E probably benign Het
Dopey1 T A 9: 86,542,442 Y2068* probably null Het
Fam26e A G 10: 34,092,202 V285A possibly damaging Het
Fryl T C 5: 73,090,717 Y1019C probably damaging Het
Fsip2 G A 2: 82,986,748 C4275Y possibly damaging Het
Gapdh A G 6: 125,162,701 V202A probably damaging Het
Gm8394 T C 10: 85,314,281 noncoding transcript Het
Gmeb2 T C 2: 181,255,574 I250M possibly damaging Het
Gpr88 C T 3: 116,252,309 G118R probably damaging Het
Hdhd3 C A 4: 62,499,370 V190L possibly damaging Het
Heg1 C T 16: 33,726,919 T461M probably damaging Het
Hspg2 A G 4: 137,518,772 Y989C probably damaging Het
Ift74 A T 4: 94,632,734 M175L probably benign Het
Kcnh3 G A 15: 99,226,533 R101Q possibly damaging Het
Kif20b G T 19: 34,941,321 V702F probably benign Het
Klhl1 A G 14: 96,123,215 probably null Het
Lrrk2 T C 15: 91,734,046 V916A probably benign Het
Mpp4 A T 1: 59,121,376 D589E probably damaging Het
Msl2 T C 9: 101,101,818 C464R probably damaging Het
Mucl2 A T 15: 103,897,566 S42T probably benign Het
Musk T A 4: 58,373,613 L838Q probably damaging Het
Nos1 A G 5: 117,936,445 H1052R probably damaging Het
Olfr1151 T C 2: 87,857,241 V22A probably benign Het
Olfr1420 A G 19: 11,896,929 R303G probably benign Het
Olfr352 T A 2: 36,870,268 I234N probably benign Het
Olfr463 T C 11: 87,893,223 R234G possibly damaging Het
Olfr52 T A 2: 86,182,102 Q3L probably benign Het
Olfr521 A T 7: 99,767,389 I76F probably damaging Het
Olfr672 C A 7: 104,996,178 C242F probably damaging Het
Olfr683 G A 7: 105,143,660 S211F probably benign Het
Olfr960 C T 9: 39,623,183 T20I probably damaging Het
Pigr A T 1: 130,844,527 S161C probably damaging Het
Polr1e T C 4: 45,029,369 S325P probably damaging Het
Prrc2a A T 17: 35,150,084 V1992E probably damaging Het
Ptpdc1 T C 13: 48,586,369 K468E probably benign Het
Rab22a A G 2: 173,661,504 T37A probably damaging Het
Rai14 T A 15: 10,575,159 K571I probably damaging Het
Reck G A 4: 43,930,979 G660D probably damaging Het
Rgs4 T C 1: 169,745,238 D43G possibly damaging Het
Ryr2 A T 13: 11,584,154 D4645E probably damaging Het
Sf3b3 A G 8: 110,823,470 S639P probably damaging Het
Slc27a4 G T 2: 29,811,660 R430L probably damaging Het
Slfn1 T A 11: 83,121,944 Y295* probably null Het
Slfn5 C T 11: 82,956,592 S101L probably damaging Het
Sult1d1 CCATG CCATGGCATG 5: 87,559,770 probably null Het
Tchh A T 3: 93,444,112 Q286H unknown Het
Tmem184c A T 8: 77,604,723 Y172* probably null Het
Tsc22d1 T G 14: 76,418,826 M833R possibly damaging Het
Ugt1a7c G T 1: 88,095,879 L253F probably damaging Het
Usp19 C T 9: 108,492,567 probably benign Het
Xirp2 T A 2: 67,524,804 I3303K possibly damaging Het
Zfp574 G A 7: 25,080,332 A260T probably benign Het
Zswim6 A G 13: 107,744,107 noncoding transcript Het
Other mutations in Pard3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pard3 APN 8 127359818 splice site probably benign
IGL00484:Pard3 APN 8 127371846 missense probably benign 0.05
IGL00674:Pard3 APN 8 127388678 missense probably damaging 1.00
IGL01471:Pard3 APN 8 127378246 missense probably benign 0.01
IGL01505:Pard3 APN 8 127324063 missense probably damaging 1.00
IGL02252:Pard3 APN 8 127398756 missense probably benign 0.09
IGL02511:Pard3 APN 8 127161320 splice site probably benign
IGL02838:Pard3 APN 8 127426647 missense probably damaging 0.99
IGL02948:Pard3 APN 8 127306494 missense probably benign 0.00
IGL02987:Pard3 APN 8 127389491 missense probably damaging 0.98
IGL03037:Pard3 APN 8 127306494 missense probably benign 0.00
IGL03084:Pard3 APN 8 127593092 missense probably damaging 0.96
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0025:Pard3 UTSW 8 127161308 missense probably damaging 1.00
R0029:Pard3 UTSW 8 127426758 splice site probably benign
R0109:Pard3 UTSW 8 127398666 missense probably damaging 1.00
R0309:Pard3 UTSW 8 127376897 splice site probably benign
R0415:Pard3 UTSW 8 127610566 missense probably damaging 1.00
R0507:Pard3 UTSW 8 127371486 splice site probably benign
R1055:Pard3 UTSW 8 127378280 missense probably benign 0.34
R1305:Pard3 UTSW 8 127306410 missense possibly damaging 0.62
R1619:Pard3 UTSW 8 127380502 missense probably benign 0.02
R1855:Pard3 UTSW 8 127447812 splice site probably null
R2001:Pard3 UTSW 8 127064347 utr 5 prime probably null
R2060:Pard3 UTSW 8 127398604 missense probably benign 0.05
R2064:Pard3 UTSW 8 127610611 missense probably damaging 1.00
R2113:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R2136:Pard3 UTSW 8 127376885 critical splice donor site probably null
R2224:Pard3 UTSW 8 127359776 missense probably damaging 1.00
R2252:Pard3 UTSW 8 127610599 missense probably damaging 1.00
R3870:Pard3 UTSW 8 127409686 missense probably damaging 1.00
R4154:Pard3 UTSW 8 127474396 missense probably damaging 1.00
R4212:Pard3 UTSW 8 127610458 missense probably benign 0.43
R4243:Pard3 UTSW 8 127371647 missense probably benign 0.09
R4523:Pard3 UTSW 8 127398627 missense probably benign 0.08
R4857:Pard3 UTSW 8 127324054 missense probably damaging 0.98
R4876:Pard3 UTSW 8 127561469 intron probably benign
R4877:Pard3 UTSW 8 127388537 missense probably damaging 1.00
R5197:Pard3 UTSW 8 127073290 splice site probably null
R5215:Pard3 UTSW 8 127378264 missense probably damaging 1.00
R5279:Pard3 UTSW 8 127460386 critical splice donor site probably null
R5349:Pard3 UTSW 8 127415743 missense probably damaging 1.00
R5479:Pard3 UTSW 8 127370355 missense probably damaging 1.00
R5514:Pard3 UTSW 8 127426605 missense probably damaging 1.00
R5681:Pard3 UTSW 8 127389433 missense possibly damaging 0.81
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6034:Pard3 UTSW 8 127064327 utr 5 prime probably benign
R6187:Pard3 UTSW 8 127073273 missense probably benign 0.00
R6382:Pard3 UTSW 8 127376783 missense probably damaging 1.00
R6774:Pard3 UTSW 8 127410747 missense probably damaging 0.98
R7130:Pard3 UTSW 8 127415683 missense probably damaging 1.00
R7267:Pard3 UTSW 8 127371575 missense probably damaging 0.97
R7358:Pard3 UTSW 8 127593092 missense probably damaging 0.98
R7528:Pard3 UTSW 8 127603165 missense probably damaging 1.00
R7537:Pard3 UTSW 8 127610582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGGAATGTCTAAAAGGCTG -3'
(R):5'- TGTTCTCCTGACAAACCCGC -3'

Sequencing Primer
(F):5'- CTGAAATAGACAGAGGCTACAGC -3'
(R):5'- AGAGATAAATGATGGCTCTCCC -3'
Posted On2017-02-28