Incidental Mutation 'R5935:Adam26b'
List |< first << previous [record 59 of 1871] next >> last >|
ID462182
Institutional Source Beutler Lab
Gene Symbol Adam26b
Ensembl Gene ENSMUSG00000063900
Gene Namea disintegrin and metallopeptidase domain 26B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5935 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location43519762-43528106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 43521298 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 222 (M222I)
Ref Sequence ENSEMBL: ENSMUSP00000079032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080135]
Predicted Effect probably benign
Transcript: ENSMUST00000080135
AA Change: M222I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079032
Gene: ENSMUSG00000063900
AA Change: M222I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 4.9e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 1.3e-8 PFAM
Pfam:Reprolysin 195 385 9.9e-50 PFAM
Pfam:Reprolysin_2 215 377 3.9e-15 PFAM
Pfam:Reprolysin_3 219 340 2e-15 PFAM
DISIN 401 476 5.88e-40 SMART
ACR 477 613 7.69e-64 SMART
low complexity region 631 642 N/A INTRINSIC
transmembrane domain 670 692 N/A INTRINSIC
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,465 L230P probably benign Het
6430531B16Rik G A 7: 139,976,613 H154Y probably benign Het
Ahnak T C 19: 9,015,182 V4610A possibly damaging Het
Ankrd13c C T 3: 157,947,583 silent Het
Cables2 A G 2: 180,262,048 probably benign Het
Cabp2 C A 19: 4,086,497 A181D probably damaging Het
Camsap3 A G 8: 3,601,999 D265G probably damaging Het
Cbs G T 17: 31,632,879 T50N probably damaging Het
Ccdc129 A T 6: 55,897,769 R235* probably null Het
Cenpa A T 5: 30,673,037 Q83L possibly damaging Het
Cit A T 5: 115,925,539 probably benign Het
Ckap5 A G 2: 91,615,100 E1694G possibly damaging Het
Copz1 A T 15: 103,294,770 M104L probably benign Het
Crot T A 5: 8,974,192 M335L probably benign Het
Ctnna2 T C 6: 77,143,921 D373G probably benign Het
Ctu2 G A 8: 122,476,954 probably benign Het
Cyp3a59 T A 5: 146,090,645 Y75* probably null Het
Dbi A G 1: 120,120,853 I21T probably benign Het
Dcun1d3 A G 7: 119,859,576 S79P probably benign Het
Dock10 T A 1: 80,505,587 probably benign Het
Dstyk T A 1: 132,454,137 I543N probably damaging Het
Epx G T 11: 87,865,492 A621E probably damaging Het
Farp2 G A 1: 93,620,645 probably null Het
Gm11992 C T 11: 9,052,711 P25S probably damaging Het
Grik5 A T 7: 25,059,077 M307K possibly damaging Het
Hnf1b A T 11: 83,882,677 N234I probably damaging Het
Htr2a A G 14: 74,645,090 D172G probably damaging Het
Ifit1bl2 T C 19: 34,619,728 T163A probably benign Het
Igsf10 A T 3: 59,328,157 D1534E probably benign Het
Il3ra T G 14: 14,350,799 V178G probably damaging Het
Itgb1 A T 8: 128,713,237 K136* probably null Het
Lama2 T A 10: 27,015,498 I2540F probably benign Het
Lrp8 C A 4: 107,857,296 H622Q probably damaging Het
Lrrc2 T A 9: 110,966,561 M138K probably benign Het
Lrrk2 C A 15: 91,745,831 H1242N probably benign Het
Lsm11 G C 11: 45,944,618 R99G probably benign Het
Mif4gd C T 11: 115,609,613 V40M probably benign Het
Mpp3 A T 11: 102,025,415 V37D probably damaging Het
Mre11a T A 9: 14,786,962 D35E probably damaging Het
Mroh4 C A 15: 74,621,154 V233F probably damaging Het
Npy2r A T 3: 82,540,761 S123T possibly damaging Het
Nrip2 A G 6: 128,408,398 Y264C possibly damaging Het
Obscn A G 11: 59,006,813 S6639P unknown Het
Olfr574 T A 7: 102,948,810 F105Y probably benign Het
Olfr963 C T 9: 39,669,090 T11I probably benign Het
Osbpl5 C T 7: 143,756,958 probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pcdhb8 A G 18: 37,356,190 D307G probably damaging Het
Pde1b A G 15: 103,521,439 K120E possibly damaging Het
Pdzrn4 T C 15: 92,397,374 S154P probably benign Het
Ppp1r13b T C 12: 111,830,442 K889R probably benign Het
Ppp4r3a T A 12: 101,051,613 D439V probably damaging Het
Ptk2b A G 14: 66,173,879 I401T probably damaging Het
Rab24 T C 13: 55,320,530 T153A probably damaging Het
Rarb C A 14: 16,434,264 A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Scn10a G A 9: 119,627,171 T1194I probably damaging Het
Scn3a G T 2: 65,464,836 N1514K probably damaging Het
Serpinb3d T C 1: 107,083,375 T36A probably benign Het
Shisa5 T A 9: 109,056,683 M229K possibly damaging Het
Sik2 C T 9: 50,917,131 G204R probably damaging Het
Sla C T 15: 66,793,705 G46E probably damaging Het
Slc35g3 A T 11: 69,761,683 M1K probably null Het
Slc5a7 A T 17: 54,276,944 Y439* probably null Het
Slc9a1 T C 4: 133,419,865 probably benign Het
Slitrk6 T G 14: 110,749,873 T801P probably benign Het
Spata31d1c T C 13: 65,037,080 V812A possibly damaging Het
Sphkap A C 1: 83,339,599 L59R probably damaging Het
Srsf10 C A 4: 135,856,242 R6S probably damaging Het
Supt5 T A 7: 28,329,475 R131S probably benign Het
Syne1 T C 10: 5,360,706 probably null Het
Tepp A T 8: 95,319,992 T98S possibly damaging Het
Tet2 T A 3: 133,488,535 H46L possibly damaging Het
Tnfsf4 T A 1: 161,417,248 N169K probably damaging Het
Tprg A T 16: 25,317,261 M1L possibly damaging Het
Tsen2 A G 6: 115,559,595 Y104C probably damaging Het
Ttc6 A G 12: 57,673,804 Y952C probably damaging Het
Umod A T 7: 119,471,427 I414N probably damaging Het
Usp10 G T 8: 119,947,089 V398L possibly damaging Het
Vmn2r23 A T 6: 123,741,895 I736F possibly damaging Het
Vmn2r65 C A 7: 84,943,661 G446V probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Yars2 A G 16: 16,309,471 I467V probably benign Het
Ykt6 A G 11: 5,959,338 E49G possibly damaging Het
Zan T A 5: 137,443,930 M1907L unknown Het
Zdhhc2 T C 8: 40,464,236 S225P probably damaging Het
Zfc3h1 A T 10: 115,431,357 probably benign Het
Other mutations in Adam26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Adam26b APN 8 43520179 missense probably damaging 1.00
IGL00806:Adam26b APN 8 43521342 missense probably damaging 1.00
IGL00984:Adam26b APN 8 43520373 missense possibly damaging 0.86
IGL01081:Adam26b APN 8 43519938 missense probably benign 0.00
IGL01783:Adam26b APN 8 43521761 missense probably benign 0.30
IGL02021:Adam26b APN 8 43519872 missense probably benign
IGL02707:Adam26b APN 8 43519858 utr 3 prime probably benign
IGL03112:Adam26b APN 8 43521512 missense probably benign
R0195:Adam26b UTSW 8 43520270 missense probably damaging 0.99
R0453:Adam26b UTSW 8 43520350 missense probably benign 0.00
R0562:Adam26b UTSW 8 43520371 missense probably benign 0.36
R0645:Adam26b UTSW 8 43520487 missense probably damaging 1.00
R0763:Adam26b UTSW 8 43520564 missense probably damaging 1.00
R1697:Adam26b UTSW 8 43520963 missense probably damaging 0.98
R1739:Adam26b UTSW 8 43521677 missense probably damaging 1.00
R1751:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1767:Adam26b UTSW 8 43519911 missense probably benign 0.00
R1994:Adam26b UTSW 8 43520639 missense probably benign 0.44
R3747:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3748:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3750:Adam26b UTSW 8 43521197 missense probably benign 0.07
R3771:Adam26b UTSW 8 43520714 missense probably damaging 1.00
R4027:Adam26b UTSW 8 43520372 missense probably benign 0.09
R4652:Adam26b UTSW 8 43521338 missense possibly damaging 0.49
R4790:Adam26b UTSW 8 43520727 missense probably benign 0.19
R4859:Adam26b UTSW 8 43520259 missense possibly damaging 0.80
R5059:Adam26b UTSW 8 43520600 missense probably damaging 1.00
R5191:Adam26b UTSW 8 43519991 missense probably damaging 1.00
R5540:Adam26b UTSW 8 43521617 missense probably damaging 1.00
R5568:Adam26b UTSW 8 43520492 missense probably benign 0.00
R5886:Adam26b UTSW 8 43520273 missense possibly damaging 0.72
R5983:Adam26b UTSW 8 43521341 missense probably damaging 1.00
R6544:Adam26b UTSW 8 43521781 missense probably damaging 0.98
R6610:Adam26b UTSW 8 43521153 missense probably damaging 1.00
R6668:Adam26b UTSW 8 43520690 missense possibly damaging 0.72
R6966:Adam26b UTSW 8 43521435 missense possibly damaging 0.51
X0066:Adam26b UTSW 8 43520004 missense probably damaging 0.97
Z1088:Adam26b UTSW 8 43520597 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGATTGCCAAACATGTTTTGC -3'
(R):5'- TGGCTTACAAAATGGACAATGG -3'

Sequencing Primer
(F):5'- GCCAAACATGTTTTGCTTCCAAG -3'
(R):5'- ATGGGGATTCAGAACCATCTC -3'
Posted On2017-02-28