Incidental Mutation 'R5935:Syne1'
ID462194
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5935 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) T to C at 5360706 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000214945] [ENSMUST00000215295]
Predicted Effect probably benign
Transcript: ENSMUST00000041639
AA Change: K624E

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: K624E

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104408
Predicted Effect probably null
Transcript: ENSMUST00000214945
Predicted Effect probably benign
Transcript: ENSMUST00000215295
AA Change: K624E

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215887
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (92/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,465 L230P probably benign Het
6430531B16Rik G A 7: 139,976,613 H154Y probably benign Het
Adam26b C G 8: 43,521,298 M222I probably benign Het
Ahnak T C 19: 9,015,182 V4610A possibly damaging Het
Ankrd13c C T 3: 157,947,583 silent Het
Cables2 A G 2: 180,262,048 probably benign Het
Cabp2 C A 19: 4,086,497 A181D probably damaging Het
Camsap3 A G 8: 3,601,999 D265G probably damaging Het
Cbs G T 17: 31,632,879 T50N probably damaging Het
Ccdc129 A T 6: 55,897,769 R235* probably null Het
Cenpa A T 5: 30,673,037 Q83L possibly damaging Het
Cit A T 5: 115,925,539 probably benign Het
Ckap5 A G 2: 91,615,100 E1694G possibly damaging Het
Copz1 A T 15: 103,294,770 M104L probably benign Het
Crot T A 5: 8,974,192 M335L probably benign Het
Ctnna2 T C 6: 77,143,921 D373G probably benign Het
Ctu2 G A 8: 122,476,954 probably benign Het
Cyp3a59 T A 5: 146,090,645 Y75* probably null Het
Dbi A G 1: 120,120,853 I21T probably benign Het
Dcun1d3 A G 7: 119,859,576 S79P probably benign Het
Dock10 T A 1: 80,505,587 probably benign Het
Dstyk T A 1: 132,454,137 I543N probably damaging Het
Epx G T 11: 87,865,492 A621E probably damaging Het
Farp2 G A 1: 93,620,645 probably null Het
Gm11992 C T 11: 9,052,711 P25S probably damaging Het
Grik5 A T 7: 25,059,077 M307K possibly damaging Het
Hnf1b A T 11: 83,882,677 N234I probably damaging Het
Htr2a A G 14: 74,645,090 D172G probably damaging Het
Ifit1bl2 T C 19: 34,619,728 T163A probably benign Het
Igsf10 A T 3: 59,328,157 D1534E probably benign Het
Il3ra T G 14: 14,350,799 V178G probably damaging Het
Itgb1 A T 8: 128,713,237 K136* probably null Het
Lama2 T A 10: 27,015,498 I2540F probably benign Het
Lrp8 C A 4: 107,857,296 H622Q probably damaging Het
Lrrc2 T A 9: 110,966,561 M138K probably benign Het
Lrrk2 C A 15: 91,745,831 H1242N probably benign Het
Lsm11 G C 11: 45,944,618 R99G probably benign Het
Mif4gd C T 11: 115,609,613 V40M probably benign Het
Mpp3 A T 11: 102,025,415 V37D probably damaging Het
Mre11a T A 9: 14,786,962 D35E probably damaging Het
Mroh4 C A 15: 74,621,154 V233F probably damaging Het
Npy2r A T 3: 82,540,761 S123T possibly damaging Het
Nrip2 A G 6: 128,408,398 Y264C possibly damaging Het
Obscn A G 11: 59,006,813 S6639P unknown Het
Olfr574 T A 7: 102,948,810 F105Y probably benign Het
Olfr963 C T 9: 39,669,090 T11I probably benign Het
Osbpl5 C T 7: 143,756,958 probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pcdhb8 A G 18: 37,356,190 D307G probably damaging Het
Pde1b A G 15: 103,521,439 K120E possibly damaging Het
Pdzrn4 T C 15: 92,397,374 S154P probably benign Het
Ppp1r13b T C 12: 111,830,442 K889R probably benign Het
Ppp4r3a T A 12: 101,051,613 D439V probably damaging Het
Ptk2b A G 14: 66,173,879 I401T probably damaging Het
Rab24 T C 13: 55,320,530 T153A probably damaging Het
Rarb C A 14: 16,434,264 A305S probably damaging Het
Rc3h2 GCC GCCC 2: 37,414,733 probably null Het
Scn10a G A 9: 119,627,171 T1194I probably damaging Het
Scn3a G T 2: 65,464,836 N1514K probably damaging Het
Serpinb3d T C 1: 107,083,375 T36A probably benign Het
Shisa5 T A 9: 109,056,683 M229K possibly damaging Het
Sik2 C T 9: 50,917,131 G204R probably damaging Het
Sla C T 15: 66,793,705 G46E probably damaging Het
Slc35g3 A T 11: 69,761,683 M1K probably null Het
Slc5a7 A T 17: 54,276,944 Y439* probably null Het
Slc9a1 T C 4: 133,419,865 probably benign Het
Slitrk6 T G 14: 110,749,873 T801P probably benign Het
Spata31d1c T C 13: 65,037,080 V812A possibly damaging Het
Sphkap A C 1: 83,339,599 L59R probably damaging Het
Srsf10 C A 4: 135,856,242 R6S probably damaging Het
Supt5 T A 7: 28,329,475 R131S probably benign Het
Tepp A T 8: 95,319,992 T98S possibly damaging Het
Tet2 T A 3: 133,488,535 H46L possibly damaging Het
Tnfsf4 T A 1: 161,417,248 N169K probably damaging Het
Tprg A T 16: 25,317,261 M1L possibly damaging Het
Tsen2 A G 6: 115,559,595 Y104C probably damaging Het
Ttc6 A G 12: 57,673,804 Y952C probably damaging Het
Umod A T 7: 119,471,427 I414N probably damaging Het
Usp10 G T 8: 119,947,089 V398L possibly damaging Het
Vmn2r23 A T 6: 123,741,895 I736F possibly damaging Het
Vmn2r65 C A 7: 84,943,661 G446V probably benign Het
Wbp1l C T 19: 46,654,180 R191* probably null Het
Yars2 A G 16: 16,309,471 I467V probably benign Het
Ykt6 A G 11: 5,959,338 E49G possibly damaging Het
Zan T A 5: 137,443,930 M1907L unknown Het
Zdhhc2 T C 8: 40,464,236 S225P probably damaging Het
Zfc3h1 A T 10: 115,431,357 probably benign Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6885:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGCCTTTCTGAATGAGAATG -3'
(R):5'- TGACTCAGTGGAGGAAGCTG -3'

Sequencing Primer
(F):5'- GAGATCTCTCTTCACAGAGCTTTGAC -3'
(R):5'- GCTGAGAACGTGATGAAATTCATG -3'
Posted On2017-02-28