Incidental Mutation 'R5937:Olfr1462'
ID462350
Institutional Source Beutler Lab
Gene Symbol Olfr1462
Ensembl Gene ENSMUSG00000094721
Gene Nameolfactory receptor 1462
SynonymsGA_x6K02T2RE5P-3517488-3518411, MOR202-13
MMRRC Submission 043242-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5937 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13185734-13193775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13191311 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 215 (S215T)
Ref Sequence ENSEMBL: ENSMUSP00000147174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076832] [ENSMUST00000208533]
Predicted Effect probably damaging
Transcript: ENSMUST00000076832
AA Change: S215T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076107
Gene: ENSMUSG00000094721
AA Change: S215T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.3e-51 PFAM
Pfam:7tm_1 39 288 6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208533
AA Change: S215T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,919,646 W314R probably benign Het
Adgrv1 A T 13: 81,107,075 V6143E probably damaging Het
Agap3 C T 5: 24,477,817 T261I probably damaging Het
Ano6 T C 15: 95,913,957 I241T probably damaging Het
Arhgef28 T C 13: 97,939,543 T1328A probably benign Het
Capn10 C T 1: 92,939,383 R112W probably damaging Het
Car5a A T 8: 121,939,821 W46R probably damaging Het
Cntn6 C A 6: 104,833,103 T582K possibly damaging Het
Ctsh T C 9: 90,061,456 V60A probably benign Het
Ctsll3 A G 13: 60,799,596 F259L probably damaging Het
Fam228a T C 12: 4,737,725 E16G probably damaging Het
G3bp2 A G 5: 92,055,397 I388T probably damaging Het
Galnt5 A T 2: 58,038,937 K926N probably benign Het
Gm10097 G A 10: 5,069,485 probably benign Het
Gm9978 T A 10: 78,486,841 noncoding transcript Het
Gria1 A G 11: 57,189,733 T112A probably benign Het
Hnrnpk A C 13: 58,395,202 V134G probably damaging Het
Insr A G 8: 3,174,808 V220A probably benign Het
Lhx4 A G 1: 155,710,277 I96T probably damaging Het
Lrp1 T C 10: 127,583,876 T955A possibly damaging Het
Lrtm1 T C 14: 29,021,830 V85A possibly damaging Het
Man2a2 T C 7: 80,363,503 Y514C probably damaging Het
Npas1 T A 7: 16,463,262 D226V probably benign Het
Nrcam G A 12: 44,572,291 V858I probably benign Het
Olfr293 G T 7: 86,664,476 L271F probably benign Het
Pde6b G T 5: 108,424,327 A478S probably benign Het
Pex1 T A 5: 3,624,487 N789K possibly damaging Het
Plekha6 A G 1: 133,260,101 D120G possibly damaging Het
Pomgnt1 A G 4: 116,153,913 T220A probably benign Het
Sdr39u1 A T 14: 55,897,907 I193K probably damaging Het
Sec61a2 C A 2: 5,886,557 M54I probably benign Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sra1 C T 18: 36,671,599 probably null Het
St5 A T 7: 109,557,271 C91S possibly damaging Het
Taf5 C T 19: 47,081,895 S640L probably damaging Het
Tas2r140 T A 6: 133,055,273 H174L probably benign Het
Tmem63a T A 1: 180,961,151 V351D probably damaging Het
Ttll7 C T 3: 146,944,092 Q626* probably null Het
Ubn2 T A 6: 38,463,982 V263E possibly damaging Het
Vmn2r106 C T 17: 20,285,405 W9* probably null Het
Xrcc3 C G 12: 111,807,972 C141S probably null Het
Zfp516 T A 18: 82,956,833 D385E probably damaging Het
Other mutations in Olfr1462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr1462 APN 19 13191234 missense possibly damaging 0.60
IGL01999:Olfr1462 APN 19 13191560 missense probably damaging 0.99
IGL02326:Olfr1462 APN 19 13191415 nonsense probably null
IGL03381:Olfr1462 APN 19 13191405 missense probably damaging 0.98
R1184:Olfr1462 UTSW 19 13191375 missense probably damaging 0.99
R1434:Olfr1462 UTSW 19 13191298 missense probably benign 0.19
R2161:Olfr1462 UTSW 19 13191309 missense probably damaging 0.99
R2399:Olfr1462 UTSW 19 13191345 missense probably benign 0.02
R4583:Olfr1462 UTSW 19 13190698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTCCATCTATACAGTGGATG -3'
(R):5'- TCATGCTGTAGACCAGAGGG -3'

Sequencing Primer
(F):5'- ACAGTGGATGTATTTAGTCTCTCC -3'
(R):5'- TGGAGTAGAACACAGACACAATTTTG -3'
Posted On2017-02-28