Incidental Mutation 'R5939:Spef2'
ID 462446
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Name sperm flagellar 2
Synonyms C230086A09Rik
MMRRC Submission 043243-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R5939 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 9578279-9748954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 9614301 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1215 (T1215I)
Ref Sequence ENSEMBL: ENSMUSP00000124222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]
AlphaFold Q8C9J3
Predicted Effect probably benign
Transcript: ENSMUST00000160236
AA Change: T1215I

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: T1215I

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208854
AA Change: T1215I

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 25,404,138 (GRCm39) F225I probably damaging Het
Ager G T 17: 34,817,175 (GRCm39) C38F probably damaging Het
Arel1 C A 12: 84,973,066 (GRCm39) R577L probably damaging Het
Armh1 T C 4: 117,087,119 (GRCm39) Y182C probably damaging Het
Cabp2 G T 19: 4,136,470 (GRCm39) C172F possibly damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
D630045J12Rik A C 6: 38,171,904 (GRCm39) S755A possibly damaging Het
Duox1 A T 2: 122,176,832 (GRCm39) H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 (GRCm39) V3359A probably damaging Het
Erlin2 T C 8: 27,526,554 (GRCm39) F305L probably benign Het
Gm10428 A C 11: 62,644,288 (GRCm39) probably benign Het
Gnal G A 18: 67,324,456 (GRCm39) V204M probably damaging Het
Intu T C 3: 40,647,014 (GRCm39) V629A probably damaging Het
Lrguk G T 6: 34,055,688 (GRCm39) C435F probably damaging Het
Man1c1 C T 4: 134,293,147 (GRCm39) V543M probably damaging Het
Mcm3ap A G 10: 76,344,195 (GRCm39) H1779R probably benign Het
Neb T C 2: 52,147,606 (GRCm39) T2776A probably benign Het
Nek10 A T 14: 14,931,290 (GRCm38) Y754F possibly damaging Het
Nr3c1 A G 18: 39,553,706 (GRCm39) I664T probably benign Het
Nrip1 T C 16: 76,089,010 (GRCm39) E849G probably damaging Het
Nrros A G 16: 31,962,272 (GRCm39) F546L probably benign Het
Or12e8 A C 2: 87,188,048 (GRCm39) I87L possibly damaging Het
Or5d39 T C 2: 87,979,853 (GRCm39) Y170C probably damaging Het
Pcdhb16 A G 18: 37,611,117 (GRCm39) T26A probably benign Het
Penk A G 4: 4,138,010 (GRCm39) F45S probably benign Het
Pgap4 T A 4: 49,586,412 (GRCm39) Q252L probably damaging Het
Ppp2r3d A T 9: 101,089,824 (GRCm39) N166K probably benign Het
Psmb1 A G 17: 15,718,440 (GRCm39) F29L probably damaging Het
Rab23 T C 1: 33,762,990 (GRCm39) V20A probably damaging Het
Ryr1 C T 7: 28,815,552 (GRCm39) A113T probably damaging Het
Ryr2 C T 13: 11,805,218 (GRCm39) R882K probably damaging Het
Slc6a6 A G 6: 91,731,929 (GRCm39) N586S probably benign Het
Slc9c1 A G 16: 45,368,031 (GRCm39) I207V probably benign Het
Thoc2l T C 5: 104,667,073 (GRCm39) Y532H possibly damaging Het
Tmc7 C T 7: 118,144,950 (GRCm39) A537T probably benign Het
Tmem70 T C 1: 16,747,615 (GRCm39) V243A probably benign Het
Top2b T C 14: 16,422,786 (GRCm38) Y1408H probably damaging Het
Tpcn1 A T 5: 120,677,892 (GRCm39) F642I probably damaging Het
Xirp1 T G 9: 119,847,575 (GRCm39) D436A probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9,740,621 (GRCm39) missense probably damaging 1.00
IGL00886:Spef2 APN 15 9,663,181 (GRCm39) missense probably damaging 1.00
IGL01409:Spef2 APN 15 9,716,499 (GRCm39) missense probably damaging 1.00
IGL01413:Spef2 APN 15 9,676,376 (GRCm39) missense probably benign 0.16
IGL01474:Spef2 APN 15 9,663,244 (GRCm39) missense probably benign 0.00
IGL01603:Spef2 APN 15 9,704,466 (GRCm39) missense probably damaging 0.99
IGL02320:Spef2 APN 15 9,717,662 (GRCm39) missense probably damaging 0.99
IGL02570:Spef2 APN 15 9,717,584 (GRCm39) nonsense probably null
IGL02605:Spef2 APN 15 9,725,238 (GRCm39) missense probably damaging 0.99
IGL02890:Spef2 APN 15 9,748,853 (GRCm39) start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9,679,432 (GRCm39) missense probably damaging 1.00
IGL02942:Spef2 APN 15 9,668,960 (GRCm39) missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9,713,329 (GRCm39) missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9,725,192 (GRCm39) splice site probably benign
IGL03263:Spef2 APN 15 9,667,305 (GRCm39) missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9,676,466 (GRCm39) missense probably benign 0.01
R0101:Spef2 UTSW 15 9,713,194 (GRCm39) missense probably damaging 1.00
R0101:Spef2 UTSW 15 9,713,194 (GRCm39) missense probably damaging 1.00
R0183:Spef2 UTSW 15 9,716,445 (GRCm39) missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9,584,148 (GRCm39) missense probably damaging 1.00
R0511:Spef2 UTSW 15 9,584,070 (GRCm39) critical splice donor site probably null
R0617:Spef2 UTSW 15 9,592,844 (GRCm39) missense probably damaging 1.00
R0655:Spef2 UTSW 15 9,626,217 (GRCm39) missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9,687,899 (GRCm39) missense probably benign 0.10
R0908:Spef2 UTSW 15 9,614,281 (GRCm39) splice site probably null
R0939:Spef2 UTSW 15 9,704,636 (GRCm39) splice site probably null
R0973:Spef2 UTSW 15 9,716,482 (GRCm39) missense probably damaging 1.00
R1371:Spef2 UTSW 15 9,725,194 (GRCm39) splice site probably benign
R1392:Spef2 UTSW 15 9,647,349 (GRCm39) missense probably benign 0.15
R1392:Spef2 UTSW 15 9,647,349 (GRCm39) missense probably benign 0.15
R1428:Spef2 UTSW 15 9,596,793 (GRCm39) unclassified probably benign
R1518:Spef2 UTSW 15 9,667,316 (GRCm39) missense probably damaging 1.00
R1585:Spef2 UTSW 15 9,596,660 (GRCm39) missense probably damaging 1.00
R1654:Spef2 UTSW 15 9,634,738 (GRCm39) missense probably damaging 0.99
R1723:Spef2 UTSW 15 9,614,295 (GRCm39) missense probably damaging 1.00
R1757:Spef2 UTSW 15 9,717,568 (GRCm39) missense probably damaging 1.00
R1812:Spef2 UTSW 15 9,679,435 (GRCm39) missense probably damaging 1.00
R1817:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1818:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1873:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1875:Spef2 UTSW 15 9,597,487 (GRCm39) missense possibly damaging 0.78
R1875:Spef2 UTSW 15 9,584,194 (GRCm39) missense probably damaging 0.96
R1897:Spef2 UTSW 15 9,729,740 (GRCm39) nonsense probably null
R1901:Spef2 UTSW 15 9,607,463 (GRCm39) missense probably damaging 1.00
R1902:Spef2 UTSW 15 9,607,463 (GRCm39) missense probably damaging 1.00
R1943:Spef2 UTSW 15 9,663,280 (GRCm39) missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9,609,602 (GRCm39) missense probably damaging 1.00
R1973:Spef2 UTSW 15 9,663,152 (GRCm39) makesense probably null
R1998:Spef2 UTSW 15 9,668,989 (GRCm39) critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9,668,989 (GRCm39) critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9,713,271 (GRCm39) missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9,589,659 (GRCm39) missense probably damaging 1.00
R2127:Spef2 UTSW 15 9,729,747 (GRCm39) missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9,626,120 (GRCm39) nonsense probably null
R2517:Spef2 UTSW 15 9,725,283 (GRCm39) missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9,630,699 (GRCm39) missense probably damaging 0.99
R2988:Spef2 UTSW 15 9,682,709 (GRCm39) missense probably benign 0.43
R3792:Spef2 UTSW 15 9,704,622 (GRCm39) missense probably damaging 1.00
R4154:Spef2 UTSW 15 9,626,107 (GRCm39) missense probably benign 0.13
R4159:Spef2 UTSW 15 9,676,407 (GRCm39) missense probably damaging 1.00
R4199:Spef2 UTSW 15 9,667,366 (GRCm39) missense probably damaging 1.00
R4320:Spef2 UTSW 15 9,679,429 (GRCm39) missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9,679,429 (GRCm39) missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9,647,303 (GRCm39) missense probably damaging 1.00
R4625:Spef2 UTSW 15 9,647,524 (GRCm39) missense probably damaging 1.00
R4669:Spef2 UTSW 15 9,676,459 (GRCm39) missense probably benign 0.42
R4684:Spef2 UTSW 15 9,647,576 (GRCm39) missense probably benign 0.44
R4761:Spef2 UTSW 15 9,653,040 (GRCm39) missense probably damaging 1.00
R4839:Spef2 UTSW 15 9,713,264 (GRCm39) nonsense probably null
R5004:Spef2 UTSW 15 9,578,413 (GRCm39) missense probably benign 0.02
R5157:Spef2 UTSW 15 9,668,877 (GRCm39) nonsense probably null
R5230:Spef2 UTSW 15 9,667,316 (GRCm39) missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9,596,777 (GRCm39) missense probably damaging 0.98
R5400:Spef2 UTSW 15 9,614,367 (GRCm39) missense probably damaging 1.00
R5591:Spef2 UTSW 15 9,583,922 (GRCm39) missense probably benign 0.02
R5599:Spef2 UTSW 15 9,729,789 (GRCm39) missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9,609,606 (GRCm39) missense probably damaging 0.96
R5787:Spef2 UTSW 15 9,748,812 (GRCm39) missense possibly damaging 0.91
R6177:Spef2 UTSW 15 9,727,618 (GRCm39) missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9,626,059 (GRCm39) missense probably damaging 1.00
R6665:Spef2 UTSW 15 9,600,604 (GRCm39) critical splice donor site probably null
R6944:Spef2 UTSW 15 9,592,835 (GRCm39) missense probably damaging 1.00
R6956:Spef2 UTSW 15 9,685,021 (GRCm39) missense probably damaging 1.00
R6968:Spef2 UTSW 15 9,597,426 (GRCm39) missense probably benign 0.02
R7089:Spef2 UTSW 15 9,725,257 (GRCm39) missense probably damaging 1.00
R7117:Spef2 UTSW 15 9,729,924 (GRCm39) missense probably damaging 1.00
R7161:Spef2 UTSW 15 9,717,689 (GRCm39) missense probably benign 0.29
R7223:Spef2 UTSW 15 9,601,726 (GRCm39) missense unknown
R7263:Spef2 UTSW 15 9,653,098 (GRCm39) splice site probably null
R7270:Spef2 UTSW 15 9,600,066 (GRCm39) critical splice donor site probably null
R7303:Spef2 UTSW 15 9,647,576 (GRCm39) missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9,584,293 (GRCm39) missense probably benign 0.02
R7464:Spef2 UTSW 15 9,740,671 (GRCm39) missense probably benign 0.23
R7498:Spef2 UTSW 15 9,727,625 (GRCm39) missense probably benign
R7587:Spef2 UTSW 15 9,713,305 (GRCm39) missense probably damaging 1.00
R7748:Spef2 UTSW 15 9,653,031 (GRCm39) missense probably damaging 0.98
R7772:Spef2 UTSW 15 9,704,567 (GRCm39) missense probably damaging 0.99
R7838:Spef2 UTSW 15 9,609,637 (GRCm39) missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9,596,730 (GRCm39) missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9,687,981 (GRCm39) missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9,717,649 (GRCm39) missense probably damaging 1.00
R7943:Spef2 UTSW 15 9,601,171 (GRCm39) missense unknown
R8105:Spef2 UTSW 15 9,682,748 (GRCm39) missense probably benign 0.06
R8151:Spef2 UTSW 15 9,601,598 (GRCm39) missense unknown
R8296:Spef2 UTSW 15 9,727,629 (GRCm39) missense probably benign 0.06
R8393:Spef2 UTSW 15 9,676,615 (GRCm39) missense probably benign 0.27
R8405:Spef2 UTSW 15 9,612,643 (GRCm39) missense probably benign 0.00
R8552:Spef2 UTSW 15 9,600,765 (GRCm39) intron probably benign
R8691:Spef2 UTSW 15 9,602,005 (GRCm39) nonsense probably null
R8751:Spef2 UTSW 15 9,729,723 (GRCm39) nonsense probably null
R8847:Spef2 UTSW 15 9,668,913 (GRCm39) missense probably benign
R8864:Spef2 UTSW 15 9,599,833 (GRCm39) missense unknown
R8868:Spef2 UTSW 15 9,729,747 (GRCm39) missense possibly damaging 0.53
R8916:Spef2 UTSW 15 9,725,266 (GRCm39) nonsense probably null
R8935:Spef2 UTSW 15 9,607,436 (GRCm39) missense probably damaging 0.98
R8961:Spef2 UTSW 15 9,647,414 (GRCm39) missense possibly damaging 0.92
R8978:Spef2 UTSW 15 9,725,263 (GRCm39) missense possibly damaging 0.81
R9062:Spef2 UTSW 15 9,601,717 (GRCm39) missense unknown
R9076:Spef2 UTSW 15 9,653,091 (GRCm39) missense probably benign 0.13
R9149:Spef2 UTSW 15 9,717,568 (GRCm39) missense probably damaging 1.00
R9162:Spef2 UTSW 15 9,602,017 (GRCm39) missense unknown
R9216:Spef2 UTSW 15 9,647,611 (GRCm39) missense probably damaging 1.00
R9240:Spef2 UTSW 15 9,578,401 (GRCm39) nonsense probably null
R9278:Spef2 UTSW 15 9,727,495 (GRCm39) critical splice donor site probably null
R9341:Spef2 UTSW 15 9,713,190 (GRCm39) missense probably damaging 1.00
R9343:Spef2 UTSW 15 9,713,190 (GRCm39) missense probably damaging 1.00
R9389:Spef2 UTSW 15 9,725,307 (GRCm39) missense probably damaging 0.96
R9476:Spef2 UTSW 15 9,713,203 (GRCm39) missense probably damaging 1.00
R9510:Spef2 UTSW 15 9,713,203 (GRCm39) missense probably damaging 1.00
R9537:Spef2 UTSW 15 9,601,885 (GRCm39) missense unknown
R9575:Spef2 UTSW 15 9,596,672 (GRCm39) missense probably damaging 1.00
R9597:Spef2 UTSW 15 9,599,897 (GRCm39) missense unknown
R9765:Spef2 UTSW 15 9,601,945 (GRCm39) missense unknown
X0025:Spef2 UTSW 15 9,596,708 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTAAAATGAGTTAGGTCGTGC -3'
(R):5'- ATTTGCTGAACGCCATCCTAAC -3'

Sequencing Primer
(F):5'- TGGTTTGCCAACTACAACCACAG -3'
(R):5'- CTGAAAATACTGCTACCATACAGG -3'
Posted On 2017-02-28