Incidental Mutation 'R0568:Acnat1'
ID46251
Institutional Source Beutler Lab
Gene Symbol Acnat1
Ensembl Gene ENSMUSG00000070985
Gene Nameacyl-coenzyme A amino acid N-acyltransferase 1
Synonyms
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0568 (G1)
Quality Score176
Status Validated
Chromosome4
Chromosomal Location49447105-49473912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49451003 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 36 (T36I)
Ref Sequence ENSEMBL: ENSMUSP00000121168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095086] [ENSMUST00000107697] [ENSMUST00000135976]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095086
AA Change: T36I

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092702
Gene: ENSMUSG00000070985
AA Change: T36I

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 2.2e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:Abhydrolase_5 170 360 3.6e-8 PFAM
Pfam:FSH1 191 361 4.5e-7 PFAM
Pfam:BAAT_C 206 411 5.5e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107697
AA Change: T36I

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103325
Gene: ENSMUSG00000070985
AA Change: T36I

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 5.7e-42 PFAM
Pfam:Abhydrolase_5 156 342 3.3e-8 PFAM
Pfam:BAAT_C 188 393 1.6e-74 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000135976
AA Change: T36I

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Acnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Acnat1 APN 4 49447793 missense probably benign
IGL03241:Acnat1 APN 4 49447702 missense probably benign 0.01
R0478:Acnat1 UTSW 4 49450901 missense probably damaging 1.00
R1299:Acnat1 UTSW 4 49450925 missense possibly damaging 0.94
R1538:Acnat1 UTSW 4 49447835 missense possibly damaging 0.69
R1750:Acnat1 UTSW 4 49451042 missense probably benign 0.08
R1847:Acnat1 UTSW 4 49447716 missense possibly damaging 0.71
R1913:Acnat1 UTSW 4 49447498 missense probably damaging 1.00
R2401:Acnat1 UTSW 4 49451077 missense possibly damaging 0.72
R3195:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3196:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3948:Acnat1 UTSW 4 49447477 missense possibly damaging 0.52
R4395:Acnat1 UTSW 4 49447679 missense probably benign 0.00
R4598:Acnat1 UTSW 4 49450781 missense probably benign 0.22
R4774:Acnat1 UTSW 4 49450784 missense probably benign 0.08
R6575:Acnat1 UTSW 4 49450785 missense possibly damaging 0.53
Z1088:Acnat1 UTSW 4 49447588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTTGGATGGAATCCTGACTG -3'
(R):5'- GGACAGCCTTGCCTTGGACTTTTC -3'

Sequencing Primer
(F):5'- AAGGGGCTGTTCATCACATC -3'
(R):5'- TGGACTTTTCAGTCTCCAGC -3'
Posted On2013-06-11