Incidental Mutation 'R5940:Msh3'
ID462519
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission 044132-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R5940 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92249843 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 838 (N838T)
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191550]
Predicted Effect probably damaging
Transcript: ENSMUST00000022220
AA Change: N838T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: N838T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185852
AA Change: N838T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: N838T

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186392
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191304
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,893,288 probably benign Het
1110008L16Rik T A 12: 55,304,874 W323R probably damaging Het
1500015O10Rik C T 1: 43,737,241 R41* probably null Het
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
5430419D17Rik A T 7: 131,238,263 D638V probably damaging Het
Aasdh G T 5: 76,882,898 S618R probably benign Het
Alpk1 T G 3: 127,670,946 T1228P probably benign Het
Ank3 T C 10: 69,920,486 V850A probably benign Het
Apeh A T 9: 108,091,899 probably null Het
Ash1l C T 3: 88,984,036 T1074I probably damaging Het
C3 G A 17: 57,210,244 S1297F possibly damaging Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cd93 A T 2: 148,442,232 I398N probably benign Het
Chrd G T 16: 20,734,586 R226L probably null Het
Clvs1 A T 4: 9,449,443 N344I possibly damaging Het
Cyp4v3 A T 8: 45,321,784 I111N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Cysltr2 T A 14: 73,029,949 Y107F probably damaging Het
Defb47 A T 14: 63,000,910 E28D probably benign Het
Dnajc30 T A 5: 135,064,559 Y103* probably null Het
Drap1 T C 19: 5,423,000 T160A probably benign Het
Dsp A G 13: 38,196,026 E2249G possibly damaging Het
E2f8 T A 7: 48,871,077 I499F probably benign Het
Ebf1 T A 11: 44,621,221 Y116N probably damaging Het
Ect2 C A 3: 27,115,465 E746D probably benign Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Fat4 T C 3: 38,889,649 V897A probably benign Het
Gja3 T A 14: 57,035,860 S352C probably damaging Het
Gm884 T C 11: 103,613,886 S243G probably benign Het
Gpr153 C A 4: 152,283,375 P561Q probably benign Het
Hlcs T C 16: 94,134,712 M574V probably damaging Het
Hmcn1 A G 1: 150,657,222 V3070A probably benign Het
Hsd3b2 G T 3: 98,711,971 N219K probably benign Het
Htra3 T C 5: 35,652,980 I453V possibly damaging Het
Klrc1 A T 6: 129,674,935 M220K possibly damaging Het
Kntc1 T G 5: 123,786,195 I1048S probably benign Het
Macf1 T A 4: 123,432,881 D2822V probably damaging Het
Mcu T A 10: 59,456,732 I42F possibly damaging Het
Mkln1 T A 6: 31,489,372 D521E probably damaging Het
Ms4a13 T C 19: 11,192,966 N5D possibly damaging Het
Msl2 T A 9: 101,101,091 C221* probably null Het
Ncapd2 A G 6: 125,168,869 S1310P probably benign Het
Ncoa6 A T 2: 155,415,865 M586K probably damaging Het
Ndel1 C T 11: 68,822,571 probably benign Het
Ndst4 T C 3: 125,561,419 probably benign Het
Nes T G 3: 87,975,952 V506G probably damaging Het
Nrg1 T C 8: 31,849,344 K200E probably damaging Het
Nt5c1b A G 12: 10,375,515 K295E probably damaging Het
Olfr1085 A T 2: 86,658,050 M136K probably damaging Het
Olfr1278 G A 2: 111,292,384 V39M possibly damaging Het
Olfr1487 T A 19: 13,619,153 probably null Het
Olfr750 T A 14: 51,070,722 I224L probably damaging Het
Olfr878 C T 9: 37,919,437 T260I probably damaging Het
Olfr919 G T 9: 38,697,711 Y218* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde1a A G 2: 79,887,839 probably null Het
Pds5a A G 5: 65,643,985 probably benign Het
Plbd1 A T 6: 136,613,721 probably benign Het
Plod2 T A 9: 92,591,397 V292E probably benign Het
Polg A G 7: 79,454,071 V879A possibly damaging Het
Ppargc1a C T 5: 51,473,911 A459T probably damaging Het
Psip1 T C 4: 83,476,322 E83G probably damaging Het
Rhbdf1 T C 11: 32,209,847 D843G probably benign Het
Rnpepl1 G T 1: 92,917,712 C451F probably damaging Het
Rrp1 T C 10: 78,405,415 D206G probably damaging Het
Setbp1 A T 18: 78,755,488 D1492E probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a6 C T 11: 109,473,196 probably benign Homo
Slc7a6os A G 8: 106,210,805 S37P probably damaging Het
Tenm4 T A 7: 96,845,895 S1140T probably damaging Het
Thoc6 C A 17: 23,670,341 R115L probably benign Het
Tmem63c C T 12: 87,075,172 H385Y probably benign Het
Trpm8 G T 1: 88,351,415 E649* probably null Het
Usf1 A G 1: 171,417,779 E253G possibly damaging Het
Vps13d T C 4: 145,074,975 T443A probably benign Het
Wdr86 T C 5: 24,722,662 Y93C probably damaging Het
Zfp597 A T 16: 3,865,821 I357N probably damaging Het
Zfp709 A G 8: 71,890,220 I497V possibly damaging Het
Zxdc T C 6: 90,370,325 S223P probably damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7369:Msh3 UTSW 13 92299262 missense probably benign 0.15
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATCTACGGATATTTTCCATTGGG -3'
(R):5'- TCTCTTCCCTATTGAGTACTGAAGG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- AGCCTCCCGTGCTGAGATTTAAG -3'
Posted On2017-02-28