Incidental Mutation 'R0568:Gtf2ird2'
ID46258
Institutional Source Beutler Lab
Gene Symbol Gtf2ird2
Ensembl Gene ENSMUSG00000015942
Gene NameGTF2I repeat domain containing 2
Synonyms1700012P16Rik
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134184019-134224355 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 134211242 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 302 (E302*)
Ref Sequence ENSEMBL: ENSMUSP00000016086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000123941] [ENSMUST00000152587]
Predicted Effect probably null
Transcript: ENSMUST00000016086
AA Change: E302*
SMART Domains Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: E302*

DomainStartEndE-ValueType
Pfam:GTF2I 104 178 6.1e-31 PFAM
Pfam:GTF2I 328 402 1.6e-25 PFAM
Blast:Tryp_SPc 436 491 4e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128842
Predicted Effect probably benign
Transcript: ENSMUST00000135588
Predicted Effect probably benign
Transcript: ENSMUST00000152587
Meta Mutation Damage Score 0.634 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Gtf2ird2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Gtf2ird2 APN 5 134196553 missense possibly damaging 0.93
IGL01295:Gtf2ird2 APN 5 134192764 missense probably damaging 1.00
IGL01603:Gtf2ird2 APN 5 134202288 splice site probably benign
IGL01824:Gtf2ird2 APN 5 134197282 splice site probably benign
IGL02469:Gtf2ird2 APN 5 134191249 missense probably damaging 1.00
IGL02525:Gtf2ird2 APN 5 134216477 missense probably benign 0.03
IGL02567:Gtf2ird2 APN 5 134213048 unclassified probably benign
IGL02750:Gtf2ird2 APN 5 134216889 missense probably damaging 0.99
IGL02992:Gtf2ird2 APN 5 134217614 missense possibly damaging 0.79
IGL03000:Gtf2ird2 APN 5 134194906 missense probably benign 0.45
IGL03114:Gtf2ird2 APN 5 134216910 unclassified probably null
IGL03180:Gtf2ird2 APN 5 134191248 missense probably damaging 1.00
R0077:Gtf2ird2 UTSW 5 134214083 missense probably damaging 1.00
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0100:Gtf2ird2 UTSW 5 134217015 missense probably damaging 0.97
R0344:Gtf2ird2 UTSW 5 134191249 missense probably damaging 1.00
R0570:Gtf2ird2 UTSW 5 134208944 critical splice donor site probably null
R0730:Gtf2ird2 UTSW 5 134192758 nonsense probably null
R0826:Gtf2ird2 UTSW 5 134216955 missense probably damaging 1.00
R1707:Gtf2ird2 UTSW 5 134216987 missense probably damaging 1.00
R1710:Gtf2ird2 UTSW 5 134211240 missense probably benign 0.26
R2064:Gtf2ird2 UTSW 5 134216498 nonsense probably null
R2284:Gtf2ird2 UTSW 5 134217183 missense probably benign 0.05
R2375:Gtf2ird2 UTSW 5 134217135 missense probably benign 0.20
R3104:Gtf2ird2 UTSW 5 134208915 missense probably benign 0.42
R4436:Gtf2ird2 UTSW 5 134194969 missense possibly damaging 0.95
R4647:Gtf2ird2 UTSW 5 134216192 missense probably damaging 1.00
R4708:Gtf2ird2 UTSW 5 134216298 missense probably damaging 0.99
R4775:Gtf2ird2 UTSW 5 134214128 missense probably benign 0.01
R4999:Gtf2ird2 UTSW 5 134217464 missense probably damaging 0.97
R5011:Gtf2ird2 UTSW 5 134216982 missense possibly damaging 0.90
R5036:Gtf2ird2 UTSW 5 134217507 missense probably damaging 1.00
R5261:Gtf2ird2 UTSW 5 134216219 missense probably benign 0.00
R5379:Gtf2ird2 UTSW 5 134217468 missense probably benign
R5921:Gtf2ird2 UTSW 5 134217584 missense probably damaging 1.00
R6180:Gtf2ird2 UTSW 5 134216547 missense probably damaging 1.00
R6483:Gtf2ird2 UTSW 5 134211225 missense probably benign 0.00
R7355:Gtf2ird2 UTSW 5 134216649 missense probably benign 0.24
Predicted Primers
Posted On2013-06-11