Incidental Mutation 'R5919:Ms4a14'
ID462592
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission 044116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5919 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11314297 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 13 (V13F)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect possibly damaging
Transcript: ENSMUST00000187467
AA Change: V13F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: V13F

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T C 1: 151,915,498 D104G probably damaging Het
2610507B11Rik A T 11: 78,289,350 N2152I probably damaging Het
6030458C11Rik A T 15: 12,823,668 H40Q probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Adgrl1 G T 8: 83,932,610 D648Y probably damaging Het
Adgrl3 C A 5: 81,646,570 D547E probably benign Het
Aebp1 A T 11: 5,871,421 M607L probably benign Het
Angptl1 T C 1: 156,858,546 Y401H probably damaging Het
Arl4d A G 11: 101,667,136 T163A probably benign Het
Camk2b A G 11: 5,979,718 S331P probably damaging Het
Ccdc15 C T 9: 37,320,396 probably null Het
Ccdc38 A T 10: 93,578,838 I370F possibly damaging Het
Clstn1 A T 4: 149,635,246 H416L probably damaging Het
Col12a1 C T 9: 79,602,298 R3030H probably damaging Het
Cop1 T A 1: 159,319,724 V540E probably damaging Het
Crebbp C T 16: 4,108,127 R710H probably damaging Het
Dsel T C 1: 111,860,253 I851V probably benign Het
Esrp1 A G 4: 11,344,146 V642A probably damaging Het
Fam71e2 T C 7: 4,770,386 E144G possibly damaging Het
Fanci T C 7: 79,444,738 L1139P probably damaging Het
Fat1 T C 8: 45,026,873 probably null Het
Fsip2 A G 2: 82,992,609 N6229D possibly damaging Het
Gas2l3 G A 10: 89,417,055 R243W probably damaging Het
Gm7102 T C 19: 61,175,469 Y176C probably damaging Het
Gm8251 T C 1: 44,056,986 N1651D probably benign Het
Hectd1 G A 12: 51,769,072 R1406W probably damaging Het
Hecw2 T C 1: 53,937,090 H180R probably damaging Het
Ift172 T A 5: 31,260,662 Q1261L possibly damaging Het
Il17rd T C 14: 27,096,044 V230A probably damaging Het
Kif17 A T 4: 138,269,891 I42F probably damaging Het
Kif24 T C 4: 41,394,477 K799E possibly damaging Het
Lrp4 A T 2: 91,473,207 I84F probably damaging Het
Mroh7 T C 4: 106,694,312 probably null Het
Muc2 T A 7: 141,694,928 V445D probably damaging Het
Muc6 A T 7: 141,641,570 M1317K possibly damaging Het
Myof T A 19: 38,024,370 D39V possibly damaging Het
Ndufaf1 A C 2: 119,660,228 V117G possibly damaging Het
Ndufs1 C G 1: 63,143,832 *728S probably null Het
Nup188 A T 2: 30,339,894 N1375Y probably damaging Het
Oasl1 T A 5: 114,928,270 I149N probably damaging Het
Olfr1504 A G 19: 13,887,845 Y122H probably damaging Het
Pelo C A 13: 115,089,309 C204F possibly damaging Het
Phf11d A C 14: 59,356,263 probably benign Het
Rars2 T C 4: 34,657,232 L526P probably damaging Het
Rrp1 A G 10: 78,405,588 L177P probably damaging Het
S100a9 A G 3: 90,695,188 L33P probably damaging Het
Slc4a7 A G 14: 14,791,092 D1045G probably benign Het
Slc9a3 C T 13: 74,158,740 T328I probably damaging Het
Spata6 A G 4: 111,779,208 D232G probably damaging Het
Taar6 A T 10: 23,985,270 I126N probably damaging Het
Tcrg-V6 A G 13: 19,190,612 Y16C probably benign Het
Tmeff2 C A 1: 51,132,152 C182* probably null Het
Tmem178 T A 17: 80,989,758 C190S probably damaging Het
Trerf1 T G 17: 47,323,282 noncoding transcript Het
Ubn2 A G 6: 38,491,488 I1046V possibly damaging Het
Vmn1r221 A T 13: 23,217,296 noncoding transcript Het
Vmn2r2 T C 3: 64,137,302 N141S probably benign Het
Zfp64 T A 2: 168,926,499 N398Y probably benign Het
Zfp787 T G 7: 6,132,835 Q139P probably damaging Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4455:Ms4a14 UTSW 19 11303626 missense possibly damaging 0.53
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5626:Ms4a14 UTSW 19 11304055 missense probably benign
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6585:Ms4a14 UTSW 19 11303645 missense unknown
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTCTGTAGACAAACATGGAGG -3'
(R):5'- AATCAAGAGGGCTGGCACAC -3'

Sequencing Primer
(F):5'- ACATGGAGGATTAACACCTTCTCTC -3'
(R):5'- AGGGCTGGCACACTCTAGAATTC -3'
Posted On2017-02-28