Incidental Mutation 'R5771:Ppp1r12b'
ID462636
Institutional Source Beutler Lab
Gene Symbol Ppp1r12b
Ensembl Gene ENSMUSG00000073557
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12B
Synonyms9530009M10Rik, 1810037O03Rik
MMRRC Submission 043371-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R5771 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location134754658-134955942 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 134773424 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045665] [ENSMUST00000045665] [ENSMUST00000086444] [ENSMUST00000086444] [ENSMUST00000168381] [ENSMUST00000168381]
Predicted Effect probably null
Transcript: ENSMUST00000045665
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045665
SMART Domains Protein: ENSMUSP00000047463
Gene: ENSMUSG00000073557

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 2.45e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 2.45e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 974 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000086444
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086444
SMART Domains Protein: ENSMUSP00000083633
Gene: ENSMUSG00000073557

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
Pfam:PRKG1_interact 875 982 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156348
Predicted Effect probably null
Transcript: ENSMUST00000168381
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168381
SMART Domains Protein: ENSMUSP00000131406
Gene: ENSMUSG00000073557

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
ANK 56 86 8.36e1 SMART
ANK 90 119 5.32e-5 SMART
ANK 123 152 1.08e-5 SMART
ANK 216 245 1.51e-4 SMART
ANK 249 278 3.85e-2 SMART
low complexity region 351 379 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
internal_repeat_3 539 576 1.9e-5 PROSPERO
PDB:2KJY|A 608 663 3e-12 PDB
internal_repeat_3 729 766 1.9e-5 PROSPERO
low complexity region 790 800 N/A INTRINSIC
low complexity region 840 864 N/A INTRINSIC
coiled coil region 867 986 N/A INTRINSIC
Meta Mutation Damage Score 0.554 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Crebbp T C 16: 4,119,772 N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Dnah7c G A 1: 46,639,665 V1790I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Etv4 G A 11: 101,771,456 P335S probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc25a11 A C 11: 70,646,190 V13G probably damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Stard13 C A 5: 151,190,011 L28F probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Ppp1r12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Ppp1r12b APN 1 134892159 missense probably damaging 1.00
IGL01788:Ppp1r12b APN 1 134893507 missense possibly damaging 0.66
IGL01880:Ppp1r12b APN 1 134886421 critical splice donor site probably null
IGL02109:Ppp1r12b APN 1 134872805 critical splice donor site probably null
IGL02247:Ppp1r12b APN 1 134835983 missense probably benign
IGL02336:Ppp1r12b APN 1 134886506 missense probably damaging 1.00
IGL02903:Ppp1r12b APN 1 134955649 missense probably benign
IGL02963:Ppp1r12b APN 1 134886548 missense probably damaging 1.00
IGL03074:Ppp1r12b APN 1 134836020 missense probably benign 0.01
IGL03302:Ppp1r12b APN 1 134838050 splice site probably benign
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0102:Ppp1r12b UTSW 1 134835899 critical splice acceptor site probably null
R0189:Ppp1r12b UTSW 1 134865776 critical splice donor site probably null
R0556:Ppp1r12b UTSW 1 134777322 missense probably damaging 1.00
R0594:Ppp1r12b UTSW 1 134776479 missense probably damaging 1.00
R0690:Ppp1r12b UTSW 1 134876082 missense probably damaging 1.00
R1354:Ppp1r12b UTSW 1 134835983 missense probably benign 0.42
R1676:Ppp1r12b UTSW 1 134777452 missense probably damaging 1.00
R1775:Ppp1r12b UTSW 1 134893348 critical splice donor site probably null
R1839:Ppp1r12b UTSW 1 134837981 missense probably benign 0.32
R1946:Ppp1r12b UTSW 1 134892270 missense probably damaging 1.00
R1971:Ppp1r12b UTSW 1 134865913 missense probably benign 0.00
R1997:Ppp1r12b UTSW 1 134846355 intron probably benign
R3110:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3112:Ppp1r12b UTSW 1 134872832 missense probably damaging 1.00
R3908:Ppp1r12b UTSW 1 134842732 missense probably damaging 1.00
R3912:Ppp1r12b UTSW 1 134887318 missense probably damaging 1.00
R3977:Ppp1r12b UTSW 1 134765975 missense probably benign 0.00
R4243:Ppp1r12b UTSW 1 134782108 intron probably benign
R4835:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4836:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4843:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R4854:Ppp1r12b UTSW 1 134873951 missense probably damaging 1.00
R4870:Ppp1r12b UTSW 1 134949033 missense probably benign 0.00
R4881:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5024:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5054:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5055:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5056:Ppp1r12b UTSW 1 134834392 intron probably benign
R5056:Ppp1r12b UTSW 1 134955733 missense probably benign 0.21
R5158:Ppp1r12b UTSW 1 134886428 missense probably damaging 1.00
R5599:Ppp1r12b UTSW 1 134865907 missense probably benign 0.08
R5775:Ppp1r12b UTSW 1 134876042 missense probably benign
R5872:Ppp1r12b UTSW 1 134776406 missense probably benign 0.03
R5896:Ppp1r12b UTSW 1 134765981 missense probably damaging 1.00
R6060:Ppp1r12b UTSW 1 134955524 missense possibly damaging 0.82
R6129:Ppp1r12b UTSW 1 134892252 nonsense probably null
R6369:Ppp1r12b UTSW 1 134886542 missense possibly damaging 0.93
R6868:Ppp1r12b UTSW 1 134886438 missense probably benign 0.00
X0022:Ppp1r12b UTSW 1 134835873 missense probably benign 0.00
X0027:Ppp1r12b UTSW 1 134896354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGCACGTTCAAAGTAACC -3'
(R):5'- GGAAATTCCAGAACCCTGCC -3'

Sequencing Primer
(F):5'- GGACTGGTCATCAAATTACTGTCCAG -3'
(R):5'- CGCCTCTTTCTGGATGTCTGG -3'
Posted On2017-03-01