Incidental Mutation 'R5773:Gldn'
ID462644
Institutional Source Beutler Lab
Gene Symbol Gldn
Ensembl Gene ENSMUSG00000046167
Gene Namegliomedin
SynonymsCRG-L2, Crlg2
MMRRC Submission 043372-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R5773 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54286486-54341786 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 54334491 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056740]
Predicted Effect probably null
Transcript: ENSMUST00000056740
SMART Domains Protein: ENSMUSP00000056080
Gene: ENSMUSG00000046167

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Collagen 136 195 8.3e-11 PFAM
low complexity region 199 211 N/A INTRINSIC
low complexity region 213 221 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
OLF 299 543 1.97e-35 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele fail to form heminodes without overt neurological abnormalities or alteration in nerve conduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 G A 2: 155,574,694 probably null Het
Akna C T 4: 63,395,070 S272N probably benign Het
Ap2m1 T C 16: 20,543,390 V416A probably damaging Het
Atp7b A G 8: 22,027,863 F320L probably benign Het
Brd1 T C 15: 88,689,549 K1116E probably benign Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Cdh4 A G 2: 179,885,996 Y503C probably damaging Het
Cfb C A 17: 34,857,272 E166* probably null Het
Cmtm1 A T 8: 104,305,176 F90I probably damaging Het
Col1a1 A T 11: 94,939,429 K160N probably benign Het
Cradd T C 10: 95,175,961 I106V probably benign Het
Defa17 A G 8: 21,656,558 R67G probably damaging Het
Dgkh T C 14: 78,595,455 N765S probably damaging Het
Dock5 A G 14: 67,796,058 V954A possibly damaging Het
Eif2d A G 1: 131,158,303 probably null Het
Epg5 T A 18: 77,960,825 F683I probably damaging Het
Fhad1 T G 4: 141,929,570 K91T probably damaging Het
Fut11 A T 14: 20,698,315 D476V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8674 T A 13: 49,901,876 noncoding transcript Het
Gtpbp6 C A 5: 110,106,891 E168D possibly damaging Het
Hinfp T A 9: 44,299,236 H163L probably benign Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Ing3 T A 6: 21,971,835 C368S probably damaging Het
Itih1 A G 14: 30,935,399 V489A possibly damaging Het
Itsn2 T C 12: 4,707,089 L1393P probably damaging Het
Kcnj13 T C 1: 87,386,667 T278A probably damaging Het
Kntc1 G A 5: 123,794,157 R1338Q probably damaging Het
Lipi T A 16: 75,573,925 T135S probably damaging Het
Map7 A G 10: 20,246,644 K152R probably benign Het
Mmp24 A G 2: 155,799,909 Y219C probably damaging Het
Nup188 T C 2: 30,322,196 V565A possibly damaging Het
Nup210 T C 6: 91,085,883 K265E probably damaging Het
Olfr1331 A G 4: 118,869,521 T247A probably damaging Het
Pcdha6 A T 18: 36,969,590 H612L probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pld2 G T 11: 70,555,932 S778I probably damaging Het
Ppef2 A C 5: 92,250,561 Y33D probably damaging Het
Ppfibp2 A T 7: 107,685,872 T129S possibly damaging Het
Prickle1 G T 15: 93,508,597 H182N probably damaging Het
R3hdm2 T A 10: 127,444,303 probably benign Het
Rbm12b1 A T 4: 12,145,765 E579V probably damaging Het
Rsf1 GGC GGCGGCGGCTGC 7: 97,579,933 probably benign Het
Slc1a6 T G 10: 78,793,277 probably null Het
Slc27a6 G T 18: 58,582,173 A283S probably damaging Het
Spats2l T A 1: 57,879,549 N27K possibly damaging Het
Srgap1 T C 10: 121,896,709 M155V probably benign Het
Stxbp5l C A 16: 37,208,097 A535S probably damaging Het
Svep1 C A 4: 58,099,985 C1353F possibly damaging Het
Taar4 T A 10: 23,961,158 I222N probably damaging Het
Tlr6 A G 5: 64,954,503 F354L probably benign Het
Trp53bp1 A G 2: 121,243,914 S452P probably damaging Het
Ttll5 GCCCTGCGGGGCTGCCACGCTGTCGATCCGGCAGCTAC G 12: 85,933,555 probably null Het
Usp42 A T 5: 143,713,712 M1264K probably benign Het
Zfp865 A T 7: 5,034,694 probably benign Het
Zfyve26 A T 12: 79,287,737 L169Q probably damaging Het
Zmym4 A T 4: 126,905,370 N383K possibly damaging Het
Other mutations in Gldn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gldn APN 9 54338464 missense probably damaging 0.99
IGL01778:Gldn APN 9 54334492 splice site probably null
IGL02425:Gldn APN 9 54338721 missense probably damaging 1.00
R2284:Gldn UTSW 9 54286565 nonsense probably null
R2902:Gldn UTSW 9 54335814 missense possibly damaging 0.84
R3055:Gldn UTSW 9 54338523 missense probably damaging 0.96
R3683:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3684:Gldn UTSW 9 54338340 missense possibly damaging 0.58
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3732:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3733:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R3734:Gldn UTSW 9 54338662 missense possibly damaging 0.76
R4668:Gldn UTSW 9 54332018 nonsense probably null
R5228:Gldn UTSW 9 54334719 missense probably damaging 0.98
R5574:Gldn UTSW 9 54312922 missense probably damaging 1.00
R5926:Gldn UTSW 9 54338438 missense possibly damaging 0.68
R5943:Gldn UTSW 9 54338437 missense possibly damaging 0.81
R6331:Gldn UTSW 9 54286878 missense probably benign 0.32
R6671:Gldn UTSW 9 54338407 missense probably damaging 1.00
R6821:Gldn UTSW 9 54338770 missense probably benign 0.01
R6897:Gldn UTSW 9 54334874 intron probably null
Predicted Primers PCR Primer
(F):5'- GCATCCAAGAAACATGGTGG -3'
(R):5'- GGGTTGCCAATGGAAGTGATC -3'

Sequencing Primer
(F):5'- ATAATGGGTACATTTGGGACTTTTC -3'
(R):5'- GCCAATGGAAGTGATCATAGATTCTG -3'
Posted On2017-03-01