Incidental Mutation 'R0568:Gm4553'
ID46265
Institutional Source Beutler Lab
Gene Symbol Gm4553
Ensembl Gene ENSMUSG00000090471
Gene Namepredicted gene 4553
Synonyms
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0568 (G1)
Quality Score160
Status Not validated
Chromosome7
Chromosomal Location142164696-142165739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142165620 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 24 (P24T)
Ref Sequence ENSEMBL: ENSMUSP00000147863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168049] [ENSMUST00000210925]
Predicted Effect unknown
Transcript: ENSMUST00000168049
AA Change: P40T
SMART Domains Protein: ENSMUSP00000131778
Gene: ENSMUSG00000090471
AA Change: P40T

DomainStartEndE-ValueType
low complexity region 18 238 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000210925
AA Change: P24T
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Gm4553
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Gm4553 APN 7 142165227 missense unknown
IGL00324:Gm4553 APN 7 142165227 missense unknown
IGL00325:Gm4553 APN 7 142165227 missense unknown
IGL00329:Gm4553 APN 7 142165227 missense unknown
IGL00332:Gm4553 APN 7 142165227 missense unknown
IGL00336:Gm4553 APN 7 142165227 missense unknown
IGL00337:Gm4553 APN 7 142165227 missense unknown
IGL00338:Gm4553 APN 7 142165227 missense unknown
IGL00339:Gm4553 APN 7 142165227 missense unknown
IGL00340:Gm4553 APN 7 142165227 missense unknown
IGL01348:Gm4553 APN 7 142165172 missense unknown
R0468:Gm4553 UTSW 7 142165625 missense unknown
R0932:Gm4553 UTSW 7 142165686 missense unknown
R4988:Gm4553 UTSW 7 142164992 unclassified probably benign
R5050:Gm4553 UTSW 7 142165036 missense unknown
R7317:Gm4553 UTSW 7 142165420 small deletion probably benign
R7372:Gm4553 UTSW 7 142165420 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAACAACAGGGTTTGCAGCAGC -3'
(R):5'- GGGTATAAAAGCCCCAGGCTCAGG -3'

Sequencing Primer
(F):5'- AGGAACTACAACCACCCTTG -3'
(R):5'- GCTCAGGAGCCTCCAAC -3'
Posted On2013-06-11