Incidental Mutation 'R0568:1810043G02Rik'
List |< first << previous [record 10 of 958] next >> last >|
ID46270
Institutional Source Beutler Lab
Gene Symbol 1810043G02Rik
Ensembl Gene ENSMUSG00000020284
Gene NameRIKEN cDNA 1810043G02 gene
SynonymsD10Jhu13e
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location77978524-77986905 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 77984547 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Cysteine at position 250 (*250C)
Ref Sequence ENSEMBL: ENSMUSP00000101036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020522] [ENSMUST00000105397] [ENSMUST00000105398]
Predicted Effect probably benign
Transcript: ENSMUST00000020522
SMART Domains Protein: ENSMUSP00000020522
Gene: ENSMUSG00000020277

DomainStartEndE-ValueType
Pfam:PFK 17 324 4.7e-109 PFAM
Pfam:PFK 401 686 1.9e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105397
AA Change: *250C
SMART Domains Protein: ENSMUSP00000101036
Gene: ENSMUSG00000020284
AA Change: *250C

DomainStartEndE-ValueType
LRRcap 104 122 3.42e-2 SMART
low complexity region 178 191 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105398
SMART Domains Protein: ENSMUSP00000101037
Gene: ENSMUSG00000020284

DomainStartEndE-ValueType
LRRcap 104 122 3.42e-2 SMART
low complexity region 178 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149074
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Four alternatively spliced transcript variants encoding four different isoforms have been found for this nuclear gene. All isoforms contain leucine-rich repeats. Three of these isoforms are mitochondrial proteins and one of them lacks the target peptide, so is not located in mitochondrion. This gene is down-regulated in Down syndrome (DS) brain, which may represent mitochondrial dysfunction in DS patients. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in 1810043G02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:1810043G02Rik APN 10 77982950 missense possibly damaging 0.62
IGL02376:1810043G02Rik APN 10 77984554 intron probably benign
IGL02671:1810043G02Rik APN 10 77980550
R0145:1810043G02Rik UTSW 10 77983556 missense probably benign 0.04
R0347:1810043G02Rik UTSW 10 77984422 missense probably damaging 0.96
R0568:1810043G02Rik UTSW 10 77983038 missense possibly damaging 0.48
R1778:1810043G02Rik UTSW 10 77982944 missense probably benign 0.00
R2279:1810043G02Rik UTSW 10 77981642 missense probably damaging 1.00
R2939:1810043G02Rik UTSW 10 77981673 missense probably benign 0.00
R4656:1810043G02Rik UTSW 10 77981616 missense probably benign 0.01
R4866:1810043G02Rik UTSW 10 77981579 splice site probably null
R6539:1810043G02Rik UTSW 10 77984488 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTATCCTGTAAAGGATGCCACCAGC -3'
(R):5'- AGGTGACATCCCTCTCCTGAAGAAG -3'

Sequencing Primer
(F):5'- CAGCCAGGTCTTAGGTCATTC -3'
(R):5'- CATCTCCAAGGGTAGGCTTGATAC -3'
Posted On2013-06-11