Incidental Mutation 'R5798:Atp9a'
ID462749
Institutional Source Beutler Lab
Gene Symbol Atp9a
Ensembl Gene ENSMUSG00000027546
Gene NameATPase, class II, type 9A
SynonymsClass II, IIa
MMRRC Submission 043210-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5798 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168634438-168742409 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 168690964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029060] [ENSMUST00000029060] [ENSMUST00000109175] [ENSMUST00000109175] [ENSMUST00000109176] [ENSMUST00000109176] [ENSMUST00000109177] [ENSMUST00000109177] [ENSMUST00000151610] [ENSMUST00000156397] [ENSMUST00000178504] [ENSMUST00000178504]
Predicted Effect probably null
Transcript: ENSMUST00000029060
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000029060
SMART Domains Protein: ENSMUSP00000029060
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109175
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109175
SMART Domains Protein: ENSMUSP00000104804
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
Pfam:E1-E2_ATPase 92 352 7.2e-21 PFAM
Pfam:Hydrolase 369 781 1.4e-19 PFAM
Pfam:HAD 372 778 1.1e-14 PFAM
Pfam:Hydrolase_like2 448 563 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109176
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109176
SMART Domains Protein: ENSMUSP00000104805
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
Pfam:PhoLip_ATPase_N 97 163 1.9e-20 PFAM
Pfam:E1-E2_ATPase 166 418 5.8e-13 PFAM
Pfam:Hydrolase 443 855 2.8e-13 PFAM
Pfam:HAD 446 852 2.4e-14 PFAM
Pfam:Cation_ATPase 522 635 1.5e-6 PFAM
Pfam:PhoLip_ATPase_C 869 1098 1.7e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109177
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109177
SMART Domains Protein: ENSMUSP00000104806
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Pfam:E1-E2_ATPase 90 350 7.2e-21 PFAM
Pfam:Hydrolase 367 779 1.4e-19 PFAM
Pfam:HAD 370 776 1.1e-14 PFAM
Pfam:Hydrolase_like2 446 561 3.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140188
Predicted Effect probably benign
Transcript: ENSMUST00000151610
SMART Domains Protein: ENSMUSP00000121364
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156397
SMART Domains Protein: ENSMUSP00000119732
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
SCOP:d1eula_ 83 189 6e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178504
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178504
SMART Domains Protein: ENSMUSP00000136793
Gene: ENSMUSG00000027546

DomainStartEndE-ValueType
low complexity region 73 88 N/A INTRINSIC
Pfam:E1-E2_ATPase 108 368 7.4e-21 PFAM
Pfam:Hydrolase 385 797 1.5e-19 PFAM
Pfam:HAD 388 794 1.1e-14 PFAM
Pfam:Hydrolase_like2 464 579 3.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,306,003 Y1226* probably null Het
Ankle2 A G 5: 110,251,535 Y587C probably damaging Het
Ankrd52 T A 10: 128,387,610 M697K probably benign Het
Arhgef40 G T 14: 51,997,032 A931S probably damaging Het
Ccdc169 T C 3: 55,140,124 V12A possibly damaging Het
Ces3b T A 8: 105,088,440 C284S probably damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Ecel1 A T 1: 87,151,483 M491K probably damaging Het
Gnaz C T 10: 75,014,871 R243W probably damaging Het
Homer1 C A 13: 93,402,095 R311S probably damaging Het
Myo5c A G 9: 75,284,198 D1118G probably benign Het
Olfr116 A G 17: 37,623,990 V215A probably benign Het
Olfr676 A C 7: 105,036,137 K313T probably benign Het
Pecam1 C T 11: 106,695,832 E185K possibly damaging Het
Rfx2 A T 17: 56,804,362 V70E possibly damaging Het
Sdk2 G A 11: 113,827,116 T1474M probably damaging Het
Slc39a12 G A 2: 14,449,826 A516T probably damaging Het
Tanc2 TGCAGCAGCAGCAGCAGCAGCAGC TGCAGCAGCAGCAGCAGCAGC 11: 105,921,855 probably benign Het
Timd2 T C 11: 46,677,237 I243M probably benign Het
Vmn2r108 A T 17: 20,472,283 S104T probably benign Het
Vmn2r56 T C 7: 12,712,965 N420S probably benign Het
Zfp148 T C 16: 33,496,143 I353T probably benign Het
Other mutations in Atp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Atp9a APN 2 168640680 missense probably benign 0.24
IGL01594:Atp9a APN 2 168691012 missense probably damaging 1.00
IGL01911:Atp9a APN 2 168653561 missense probably damaging 1.00
IGL02606:Atp9a APN 2 168652668 missense probably damaging 1.00
IGL02639:Atp9a APN 2 168649620 missense probably damaging 1.00
IGL03011:Atp9a APN 2 168652632 missense probably damaging 1.00
IGL03294:Atp9a APN 2 168689305 missense probably benign 0.04
IGL03310:Atp9a APN 2 168639959 missense probably damaging 1.00
R0114:Atp9a UTSW 2 168710856 nonsense probably null
R0194:Atp9a UTSW 2 168643885 missense probably benign 0.00
R0427:Atp9a UTSW 2 168640697 critical splice acceptor site probably null
R0508:Atp9a UTSW 2 168649526 splice site probably null
R1611:Atp9a UTSW 2 168673569 missense probably damaging 1.00
R2120:Atp9a UTSW 2 168653537 missense probably damaging 1.00
R2330:Atp9a UTSW 2 168639929 missense probably benign 0.01
R2348:Atp9a UTSW 2 168710826 splice site probably benign
R2404:Atp9a UTSW 2 168675363 critical splice acceptor site probably null
R2881:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R2882:Atp9a UTSW 2 168706214 missense probably damaging 1.00
R4029:Atp9a UTSW 2 168689325 missense probably damaging 1.00
R4371:Atp9a UTSW 2 168649615 missense probably damaging 1.00
R4411:Atp9a UTSW 2 168661933 missense probably damaging 1.00
R4446:Atp9a UTSW 2 168681997 missense possibly damaging 0.75
R4583:Atp9a UTSW 2 168689360 splice site probably null
R4626:Atp9a UTSW 2 168639943 missense probably damaging 1.00
R4661:Atp9a UTSW 2 168637672 missense possibly damaging 0.52
R4679:Atp9a UTSW 2 168661964 missense possibly damaging 0.95
R4738:Atp9a UTSW 2 168668181 missense probably benign
R5191:Atp9a UTSW 2 168662063 missense possibly damaging 0.51
R5216:Atp9a UTSW 2 168674888 missense probably benign 0.38
R5280:Atp9a UTSW 2 168639988 missense possibly damaging 0.66
R5509:Atp9a UTSW 2 168639937 missense probably damaging 1.00
R5807:Atp9a UTSW 2 168653534 missense probably damaging 0.98
R5926:Atp9a UTSW 2 168706271 missense probably damaging 1.00
R6046:Atp9a UTSW 2 168634870 missense probably benign 0.42
R6244:Atp9a UTSW 2 168689352 critical splice acceptor site probably null
R6307:Atp9a UTSW 2 168668170 missense probably benign 0.02
R6345:Atp9a UTSW 2 168676173 missense probably damaging 0.99
R6442:Atp9a UTSW 2 168649561 missense probably benign 0.01
R6459:Atp9a UTSW 2 168668013 missense probably damaging 1.00
R6769:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6771:Atp9a UTSW 2 168674900 missense probably damaging 1.00
R6841:Atp9a UTSW 2 168654220 missense possibly damaging 0.87
R7271:Atp9a UTSW 2 168734127
R7422:Atp9a UTSW 2 168648593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTTTCTTCCCGGCAG -3'
(R):5'- GCTGTTAAAGCGGAGACTGG -3'

Sequencing Primer
(F):5'- AGTCCGGTCCACCAGATG -3'
(R):5'- TTAAAGCGGAGACTGGGCTCC -3'
Posted On2017-03-01