Incidental Mutation 'R0568:Syngr3'
ID46277
Institutional Source Beutler Lab
Gene Symbol Syngr3
Ensembl Gene ENSMUSG00000007021
Gene Namesynaptogyrin 3
Synonyms
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0568 (G1)
Quality Score176
Status Validated
Chromosome17
Chromosomal Location24685092-24689955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24686581 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 140 (A140T)
Ref Sequence ENSEMBL: ENSMUSP00000007236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007236] [ENSMUST00000047179]
Predicted Effect probably benign
Transcript: ENSMUST00000007236
AA Change: A140T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000007236
Gene: ENSMUSG00000007021
AA Change: A140T

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:MARVEL 20 166 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047179
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130936
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein. The exact function of this protein is unclear, but studies of a similar murine protein suggest that it is a synaptic vesicle protein that also interacts with the dopamine transporter. The gene product belongs to the synaptogyrin gene family. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Syngr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Syngr3 APN 17 24686328 missense probably benign 0.00
IGL02739:Syngr3 APN 17 24686398 missense probably damaging 0.99
R1019:Syngr3 UTSW 17 24687560 missense possibly damaging 0.88
R1398:Syngr3 UTSW 17 24686440 missense probably benign 0.00
R1547:Syngr3 UTSW 17 24687724 missense probably damaging 0.98
R1564:Syngr3 UTSW 17 24686668 splice site probably null
R1819:Syngr3 UTSW 17 24687722 missense possibly damaging 0.85
R1946:Syngr3 UTSW 17 24687706 missense probably benign 0.26
R4094:Syngr3 UTSW 17 24689843 unclassified probably benign
R5755:Syngr3 UTSW 17 24686535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTAGGACCCAGAAAAGGTCTC -3'
(R):5'- CAGAATCTCTTTAGGGCACGCCAG -3'

Sequencing Primer
(F):5'- TACCTAGCTGATCTGTGGCAAAG -3'
(R):5'- CATGTGAATGGCAATTTGCTGG -3'
Posted On2013-06-11