Incidental Mutation 'R0568:Lipo3'
ID46278
Institutional Source Beutler Lab
Gene Symbol Lipo3
Ensembl Gene ENSMUSG00000024766
Gene Namelipase, member O3
SynonymsLipo1
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location33517740-33761951 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 33582042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025694] [ENSMUST00000112508]
Predicted Effect probably benign
Transcript: ENSMUST00000025694
SMART Domains Protein: ENSMUSP00000025694
Gene: ENSMUSG00000024766

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 4.2e-24 PFAM
Pfam:Abhydrolase_1 76 213 7.3e-16 PFAM
Pfam:Abhydrolase_5 76 370 4.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112508
SMART Domains Protein: ENSMUSP00000108127
Gene: ENSMUSG00000024766

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 33 95 8.8e-24 PFAM
Pfam:Abhydrolase_5 76 370 5.2e-12 PFAM
Pfam:Abhydrolase_6 77 384 8.5e-10 PFAM
Pfam:Abhydrolase_1 109 384 2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133269
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Lipo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Lipo3 APN 19 33559565 missense probably damaging 1.00
IGL02027:Lipo3 APN 19 33580519 nonsense probably null
IGL02047:Lipo3 APN 19 33557162 missense probably benign 0.00
IGL02586:Lipo3 APN 19 33582139 missense possibly damaging 0.95
IGL03111:Lipo3 APN 19 33582237 missense probably damaging 0.96
IGL03404:Lipo3 APN 19 33583040 splice site probably benign
R0122:Lipo3 UTSW 19 33622686 intron probably benign
R0128:Lipo3 UTSW 19 33557106 critical splice donor site probably null
R0540:Lipo3 UTSW 19 33559567 missense possibly damaging 0.62
R0551:Lipo3 UTSW 19 33580551 missense probably damaging 1.00
R0669:Lipo3 UTSW 19 33559625 missense probably benign 0.05
R2911:Lipo3 UTSW 19 33579367 missense probably benign 0.00
R3973:Lipo3 UTSW 19 33558323 missense probably damaging 1.00
R4660:Lipo3 UTSW 19 33620960 intron probably benign
R4820:Lipo3 UTSW 19 33583097 missense probably damaging 1.00
R5117:Lipo3 UTSW 19 33559552 missense probably benign
R5258:Lipo3 UTSW 19 33613843 intron probably benign
R6383:Lipo3 UTSW 19 33556431 missense probably benign 0.02
R6659:Lipo3 UTSW 19 33556428 missense possibly damaging 0.55
R6915:Lipo3 UTSW 19 33584893 missense probably damaging 1.00
R7092:Lipo3 UTSW 19 33613692 intron probably null
R7444:Lipo3 UTSW 19 33558263 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGATACGGGAGGATGTCTGTATG -3'
(R):5'- TCCAATCCGCCTGTCAACAGC -3'

Sequencing Primer
(F):5'- gtctgtaagaagactcagagacc -3'
(R):5'- GTCAACAGCCTGGCCTTC -3'
Posted On2013-06-11