Incidental Mutation 'R0569:Kcnk2'
ID46281
Institutional Source Beutler Lab
Gene Symbol Kcnk2
Ensembl Gene ENSMUSG00000037624
Gene Namepotassium channel, subfamily K, member 2
SynonymsTREK-1
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0569 (G1)
Quality Score194
Status Validated
Chromosome1
Chromosomal Location189207930-189402273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 189339801 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 110 (L110R)
Ref Sequence ENSEMBL: ENSMUSP00000142026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079451] [ENSMUST00000110920] [ENSMUST00000180044] [ENSMUST00000192723] [ENSMUST00000193319] [ENSMUST00000194172] [ENSMUST00000194402]
Predicted Effect probably damaging
Transcript: ENSMUST00000079451
AA Change: L102R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078416
Gene: ENSMUSG00000037624
AA Change: L102R

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 197 2e-20 PFAM
low complexity region 221 230 N/A INTRINSIC
Pfam:Ion_trans_2 233 313 6.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110920
AA Change: L99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106545
Gene: ENSMUSG00000037624
AA Change: L99R

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180044
AA Change: L110R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136513
Gene: ENSMUSG00000037624
AA Change: L110R

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191809
Predicted Effect probably damaging
Transcript: ENSMUST00000192723
AA Change: L99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141849
Gene: ENSMUSG00000037624
AA Change: L99R

DomainStartEndE-ValueType
Pfam:Ion_trans_2 102 183 2.4e-21 PFAM
Pfam:Ion_trans_2 211 298 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192797
Predicted Effect probably damaging
Transcript: ENSMUST00000193319
AA Change: L114R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141891
Gene: ENSMUSG00000037624
AA Change: L114R

DomainStartEndE-ValueType
Pfam:Ion_trans_2 117 198 2.5e-21 PFAM
Pfam:Ion_trans_2 226 313 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194172
AA Change: L110R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142176
Gene: ENSMUSG00000037624
AA Change: L110R

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 5e-20 PFAM
low complexity region 216 231 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194402
AA Change: L110R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142026
Gene: ENSMUSG00000037624
AA Change: L110R

DomainStartEndE-ValueType
transmembrane domain 57 76 N/A INTRINSIC
Pfam:Ion_trans_2 113 194 1.4e-19 PFAM
Pfam:Ion_trans_2 222 309 2.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195016
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased sensitivity to pharmacologically induced seizures and ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Kcnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Kcnk2 APN 1 189243014 missense probably damaging 0.96
IGL01100:Kcnk2 APN 1 189339936 missense probably damaging 1.00
IGL01872:Kcnk2 APN 1 189256583 missense probably damaging 1.00
IGL01929:Kcnk2 APN 1 189340030 missense probably damaging 1.00
IGL02643:Kcnk2 APN 1 189258779 missense possibly damaging 0.63
IGL03056:Kcnk2 APN 1 189295711 missense possibly damaging 0.82
IGL03340:Kcnk2 APN 1 189295681 missense possibly damaging 0.51
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0041:Kcnk2 UTSW 1 189295691 missense probably benign 0.44
R0279:Kcnk2 UTSW 1 189209972 missense possibly damaging 0.58
R0645:Kcnk2 UTSW 1 189256730 intron probably null
R1070:Kcnk2 UTSW 1 189256763 splice site probably benign
R1449:Kcnk2 UTSW 1 189340026 missense probably benign 0.31
R2401:Kcnk2 UTSW 1 189340017 missense possibly damaging 0.64
R4418:Kcnk2 UTSW 1 189256727 missense probably damaging 1.00
R4923:Kcnk2 UTSW 1 189339936 missense probably damaging 1.00
R5782:Kcnk2 UTSW 1 189256579 missense probably damaging 1.00
R5845:Kcnk2 UTSW 1 189277721 intron probably benign
R6140:Kcnk2 UTSW 1 189209907 missense probably damaging 0.97
R6240:Kcnk2 UTSW 1 189242982 missense probably damaging 1.00
R6881:Kcnk2 UTSW 1 189209990 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGCTTTCTCAGACCAATGCACTC -3'
(R):5'- AAAACCCACCGTGCTTGCTTCC -3'

Sequencing Primer
(F):5'- GTAAGCCCCCGTCAGTTCTAAG -3'
(R):5'- GTGGAGAGTGACTCGGC -3'
Posted On2013-06-11