Incidental Mutation 'R0569:Olfr1052'
ID46285
Institutional Source Beutler Lab
Gene Symbol Olfr1052
Ensembl Gene ENSMUSG00000047149
Gene Nameolfactory receptor 1052
SynonymsGA_x6K02T2Q125-47777498-47778436, MOR172-1
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86292455-86299233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86298597 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 260 (I260M)
Ref Sequence ENSEMBL: ENSMUSP00000149344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054746] [ENSMUST00000215090] [ENSMUST00000217166]
Predicted Effect probably damaging
Transcript: ENSMUST00000054746
AA Change: I260M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058454
Gene: ENSMUSG00000047149
AA Change: I260M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7tm_1 41 290 6.9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215090
AA Change: I260M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000217166
AA Change: I260M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Olfr1052
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Olfr1052 APN 2 86298560 missense probably damaging 0.99
IGL02988:Olfr1052 UTSW 2 86298479 missense probably damaging 0.99
R0382:Olfr1052 UTSW 2 86298593 missense probably damaging 1.00
R1476:Olfr1052 UTSW 2 86298479 missense probably damaging 0.99
R1510:Olfr1052 UTSW 2 86298371 missense probably damaging 1.00
R1667:Olfr1052 UTSW 2 86298736 missense probably null 0.02
R2912:Olfr1052 UTSW 2 86298389 missense probably damaging 0.96
R2913:Olfr1052 UTSW 2 86298389 missense probably damaging 0.96
R3937:Olfr1052 UTSW 2 86298016 missense probably damaging 1.00
R4299:Olfr1052 UTSW 2 86298241 missense possibly damaging 0.46
R4774:Olfr1052 UTSW 2 86298698 missense possibly damaging 0.91
R5027:Olfr1052 UTSW 2 86298196 missense possibly damaging 0.84
R5080:Olfr1052 UTSW 2 86297914 missense probably benign 0.22
R5254:Olfr1052 UTSW 2 86297921 missense probably damaging 1.00
R5389:Olfr1052 UTSW 2 86298217 missense possibly damaging 0.90
R6110:Olfr1052 UTSW 2 86298675 missense probably damaging 0.99
R6492:Olfr1052 UTSW 2 86298646 missense probably benign 0.05
R6810:Olfr1052 UTSW 2 86297923 missense probably benign 0.01
R7095:Olfr1052 UTSW 2 86298677 missense probably benign 0.08
R7104:Olfr1052 UTSW 2 86298220 missense probably benign
R7320:Olfr1052 UTSW 2 86297994 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTGTGACATACCATCGCTGCTGATAC -3'
(R):5'- GAGAAGGACTTCATCTCTATGGCTCTCT -3'

Sequencing Primer
(F):5'- ACCTCCATGAATGAATTTCTGC -3'
(R):5'- ATCTCTATGGCTCTCTTTGCAGC -3'
Posted On2013-06-11