Incidental Mutation 'R0569:Il6ra'
ID46292
Institutional Source Beutler Lab
Gene Symbol Il6ra
Ensembl Gene ENSMUSG00000027947
Gene Nameinterleukin 6 receptor, alpha
SynonymsIL-6R, IL-6 receptor alpha chain, Il6r, CD126
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0569 (G1)
Quality Score174
Status Validated
Chromosome3
Chromosomal Location89864059-89913196 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 89877842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029559] [ENSMUST00000197679]
Predicted Effect probably null
Transcript: ENSMUST00000029559
SMART Domains Protein: ENSMUSP00000029559
Gene: ENSMUSG00000027947

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
IGc2 38 99 1.35e-9 SMART
Pfam:IL6Ra-bind 109 210 2.9e-21 PFAM
FN3 213 298 2.18e-2 SMART
transmembrane domain 363 385 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197679
SMART Domains Protein: ENSMUSP00000143541
Gene: ENSMUSG00000027947

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 38 99 5.7e-12 SMART
Pfam:IL6Ra-bind 109 210 6.8e-19 PFAM
FN3 213 298 1.1e-4 SMART
transmembrane domain 362 384 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
Meta Mutation Damage Score 0.614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit defective T helper 17 cells development. Mice homozygous for a different knock-out allele exhibit abnormaly inflammatory response and abnormal wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Il6ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Il6ra APN 3 89886043 missense probably damaging 0.97
IGL02198:Il6ra APN 3 89890348 missense probably benign 0.07
IGL02363:Il6ra APN 3 89871253 missense probably benign 0.00
IGL03109:Il6ra APN 3 89876858 nonsense probably null
R0105:Il6ra UTSW 3 89876818 missense probably damaging 1.00
R0926:Il6ra UTSW 3 89887069 missense probably damaging 0.99
R1837:Il6ra UTSW 3 89890272 missense probably benign 0.00
R1838:Il6ra UTSW 3 89890272 missense probably benign 0.00
R3147:Il6ra UTSW 3 89885928 missense probably benign 0.29
R4478:Il6ra UTSW 3 89890290 missense probably damaging 1.00
R5470:Il6ra UTSW 3 89885995 missense probably benign 0.05
R5572:Il6ra UTSW 3 89871282 missense probably damaging 1.00
R6169:Il6ra UTSW 3 89871291 missense probably benign 0.15
R6300:Il6ra UTSW 3 89887129 missense probably damaging 0.97
R6543:Il6ra UTSW 3 89876863 missense probably damaging 1.00
R7129:Il6ra UTSW 3 89871247 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTATCGTAGCAAACAACGGCAAG -3'
(R):5'- TCGGGCACAGAGAGGTTCATTCAG -3'

Sequencing Primer
(F):5'- TGACAGGCAAgctggtgc -3'
(R):5'- CAGAGAGGTTCATTCAGGACAC -3'
Posted On2013-06-11