Incidental Mutation 'R0569:Gcn1l1'
ID46298
Institutional Source Beutler Lab
Gene Symbol Gcn1l1
Ensembl Gene ENSMUSG00000041638
Gene NameGCN1 general control of amino-acid synthesis 1-like 1 (yeast)
SynonymsGCN1L, G431004K08Rik
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115565254-115622654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 115595059 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1052 (S1052A)
Ref Sequence ENSEMBL: ENSMUSP00000069432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064454]
Predicted Effect probably benign
Transcript: ENSMUST00000064454
AA Change: S1052A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000069432
Gene: ENSMUSG00000041638
AA Change: S1052A

DomainStartEndE-ValueType
low complexity region 64 84 N/A INTRINSIC
low complexity region 108 117 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF3554 357 705 2e-61 PFAM
coiled coil region 806 866 N/A INTRINSIC
Blast:ARM 1028 1068 6e-11 BLAST
coiled coil region 1180 1203 N/A INTRINSIC
low complexity region 1457 1466 N/A INTRINSIC
low complexity region 1501 1510 N/A INTRINSIC
ARM 1527 1567 3.69e1 SMART
Blast:ARM 1602 1644 1e-5 BLAST
Blast:EZ_HEAT 1671 1704 1e-7 BLAST
low complexity region 1926 1934 N/A INTRINSIC
low complexity region 1956 1972 N/A INTRINSIC
ARM 2034 2070 9.27e1 SMART
low complexity region 2326 2334 N/A INTRINSIC
ARM 2416 2455 2.16e1 SMART
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Gcn1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Gcn1l1 APN 5 115588143 splice site probably benign
IGL00974:Gcn1l1 APN 5 115613793 missense possibly damaging 0.88
IGL01566:Gcn1l1 APN 5 115611058 missense probably damaging 1.00
IGL01843:Gcn1l1 APN 5 115619700 missense probably damaging 1.00
IGL01885:Gcn1l1 APN 5 115576115 splice site probably null
IGL02081:Gcn1l1 APN 5 115585871 missense probably damaging 1.00
IGL02118:Gcn1l1 APN 5 115610879 missense probably damaging 1.00
IGL02150:Gcn1l1 APN 5 115609868 missense probably damaging 1.00
IGL02190:Gcn1l1 APN 5 115614124 missense probably damaging 1.00
IGL02219:Gcn1l1 APN 5 115613767 missense possibly damaging 0.68
IGL02507:Gcn1l1 APN 5 115585881 missense probably benign 0.11
IGL02644:Gcn1l1 APN 5 115575191 missense probably benign
IGL02678:Gcn1l1 APN 5 115613755 missense probably damaging 0.99
IGL02748:Gcn1l1 APN 5 115610800 splice site probably null
IGL02755:Gcn1l1 APN 5 115604006 splice site probably null
IGL02896:Gcn1l1 APN 5 115619648 splice site probably benign
IGL03147:Gcn1l1 UTSW 5 115610858 missense possibly damaging 0.78
R0362:Gcn1l1 UTSW 5 115576108 splice site probably benign
R0540:Gcn1l1 UTSW 5 115588956 missense probably benign 0.00
R0570:Gcn1l1 UTSW 5 115592421 missense probably damaging 1.00
R0584:Gcn1l1 UTSW 5 115595015 missense probably damaging 1.00
R0630:Gcn1l1 UTSW 5 115581089 missense probably benign 0.06
R0656:Gcn1l1 UTSW 5 115589303 missense probably benign 0.27
R0801:Gcn1l1 UTSW 5 115591006 missense probably benign 0.12
R0890:Gcn1l1 UTSW 5 115579793 missense possibly damaging 0.77
R1400:Gcn1l1 UTSW 5 115614161 missense probably damaging 1.00
R1485:Gcn1l1 UTSW 5 115574617 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1574:Gcn1l1 UTSW 5 115615552 missense probably benign
R1673:Gcn1l1 UTSW 5 115582297 missense probably benign
R1894:Gcn1l1 UTSW 5 115589115 missense probably damaging 1.00
R2114:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2116:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2117:Gcn1l1 UTSW 5 115598825 missense probably benign 0.35
R2152:Gcn1l1 UTSW 5 115609829 missense probably benign 0.07
R2162:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R2216:Gcn1l1 UTSW 5 115593661 missense probably benign
R2218:Gcn1l1 UTSW 5 115619661 missense probably benign 0.04
R2278:Gcn1l1 UTSW 5 115611175 missense probably damaging 1.00
R2280:Gcn1l1 UTSW 5 115612730 missense probably damaging 1.00
R3719:Gcn1l1 UTSW 5 115579817 missense probably benign 0.03
R3729:Gcn1l1 UTSW 5 115583394 splice site probably benign
R3833:Gcn1l1 UTSW 5 115592132 missense probably benign 0.18
R3932:Gcn1l1 UTSW 5 115587834 missense probably benign 0.11
R4067:Gcn1l1 UTSW 5 115599088 missense probably damaging 1.00
R4152:Gcn1l1 UTSW 5 115613354 critical splice acceptor site probably null
R4179:Gcn1l1 UTSW 5 115588050 missense probably benign 0.00
R4292:Gcn1l1 UTSW 5 115576148 missense possibly damaging 0.49
R4350:Gcn1l1 UTSW 5 115603330 missense probably damaging 1.00
R4493:Gcn1l1 UTSW 5 115594144 missense probably benign
R4672:Gcn1l1 UTSW 5 115606520 missense probably damaging 1.00
R4749:Gcn1l1 UTSW 5 115614402 missense probably benign
R4753:Gcn1l1 UTSW 5 115616478 missense probably benign
R4826:Gcn1l1 UTSW 5 115593693 missense probably benign
R4873:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4875:Gcn1l1 UTSW 5 115576170 missense possibly damaging 0.92
R4932:Gcn1l1 UTSW 5 115592144 missense probably benign 0.00
R4992:Gcn1l1 UTSW 5 115599166 missense probably benign 0.29
R5049:Gcn1l1 UTSW 5 115606671 missense probably damaging 1.00
R5211:Gcn1l1 UTSW 5 115619312 missense probably benign 0.04
R5226:Gcn1l1 UTSW 5 115588067 missense probably benign 0.01
R5338:Gcn1l1 UTSW 5 115583403 missense probably benign 0.00
R5914:Gcn1l1 UTSW 5 115610135 synonymous silent
R5932:Gcn1l1 UTSW 5 115592376 missense possibly damaging 0.77
R6422:Gcn1l1 UTSW 5 115609544 missense probably damaging 1.00
R6435:Gcn1l1 UTSW 5 115611022 critical splice acceptor site probably null
R6607:Gcn1l1 UTSW 5 115609478 missense probably damaging 0.98
R6724:Gcn1l1 UTSW 5 115609158 intron probably null
R6861:Gcn1l1 UTSW 5 115611049 missense probably benign
R6875:Gcn1l1 UTSW 5 115588110 missense probably damaging 1.00
R6910:Gcn1l1 UTSW 5 115606538 missense probably benign 0.42
R6975:Gcn1l1 UTSW 5 115613459 missense probably damaging 1.00
R7027:Gcn1l1 UTSW 5 115616546 critical splice donor site probably null
R7038:Gcn1l1 UTSW 5 115611144 missense probably damaging 1.00
R7171:Gcn1l1 UTSW 5 115590293 missense probably benign 0.02
R7276:Gcn1l1 UTSW 5 115611060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAGGCTGGGATAGCACCTACG -3'
(R):5'- ACACCAAAGTGCTGGGTCAGCTAC -3'

Sequencing Primer
(F):5'- GGCCGCTTGGTTGTAAATAAAG -3'
(R):5'- TGGGTCAGCTACGCAGAG -3'
Posted On2013-06-11