Incidental Mutation 'R0569:Cyp2b10'
ID46302
Institutional Source Beutler Lab
Gene Symbol Cyp2b10
Ensembl Gene ENSMUSG00000030483
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 10
Synonymsphenobarbitol inducible, type b, p16, Cyp2b20, Cyp2b
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25897620-25926624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25897735 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 17 (L17F)
Ref Sequence ENSEMBL: ENSMUSP00000072264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005477] [ENSMUST00000072438]
Predicted Effect probably damaging
Transcript: ENSMUST00000005477
AA Change: L17F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005477
Gene: ENSMUSG00000030483
AA Change: L17F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 497 4.1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072438
AA Change: L17F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072264
Gene: ENSMUSG00000030483
AA Change: L17F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2e-152 PFAM
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP2B6, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize some xenobiotics, such as the anti-cancer drugs cyclophosphamide and ifosphamide. Transcript variants for this gene have been described; however, it has not been resolved whether these transcripts are in fact produced by this gene or by a closely related pseudogene, CYP2B7. Both the gene and the pseudogene are located in the middle of a CYP2A pseudogene found in a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Cyp2b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Cyp2b10 APN 7 25913937 missense probably damaging 0.99
IGL02341:Cyp2b10 APN 7 25911242 missense probably benign 0.33
IGL02557:Cyp2b10 APN 7 25914881 missense probably benign
R0038:Cyp2b10 UTSW 7 25914862 missense probably benign 0.21
R0393:Cyp2b10 UTSW 7 25914934 splice site probably benign
R1035:Cyp2b10 UTSW 7 25917048 missense probably benign 0.34
R1262:Cyp2b10 UTSW 7 25915411 missense probably benign 0.16
R1282:Cyp2b10 UTSW 7 25926080 missense probably damaging 1.00
R1452:Cyp2b10 UTSW 7 25925388 intron probably benign
R2163:Cyp2b10 UTSW 7 25925385 intron probably benign
R4520:Cyp2b10 UTSW 7 25911557 missense probably benign 0.05
R4831:Cyp2b10 UTSW 7 25915496 nonsense probably null
R5201:Cyp2b10 UTSW 7 25916994 missense probably damaging 1.00
R5330:Cyp2b10 UTSW 7 25913989 nonsense probably null
R5586:Cyp2b10 UTSW 7 25917012 missense probably damaging 1.00
R5964:Cyp2b10 UTSW 7 25926223 missense probably benign 0.28
R6043:Cyp2b10 UTSW 7 25917339 missense probably damaging 0.99
R6470:Cyp2b10 UTSW 7 25911656 missense possibly damaging 0.57
R6991:Cyp2b10 UTSW 7 25917355 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCACGCTCTGGACAATGAGAGAC -3'
(R):5'- GTGAAATTCTGCACGCTCACACC -3'

Sequencing Primer
(F):5'- TCTGGACAATGAGAGACAGGAG -3'
(R):5'- CAACGTAGCAAGATTTGCCTGTC -3'
Posted On2013-06-11