Incidental Mutation 'R0569:Cracr2b'
ID46304
Institutional Source Beutler Lab
Gene Symbol Cracr2b
Ensembl Gene ENSMUSG00000048200
Gene Namecalcium release activated channel regulator 2B
SynonymsEfcab4a, 6330520A15Rik
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0569 (G1)
Quality Score216
Status Validated
Chromosome7
Chromosomal Location141461094-141466613 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 141464935 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000053670] [ENSMUST00000058746] [ENSMUST00000064151] [ENSMUST00000106000] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165194] [ENSMUST00000167491] [ENSMUST00000170879] [ENSMUST00000172215] [ENSMUST00000177840] [ENSMUST00000209892] [ENSMUST00000209988] [ENSMUST00000211071]
Predicted Effect probably benign
Transcript: ENSMUST00000026583
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053670
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058746
SMART Domains Protein: ENSMUSP00000061636
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064151
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097947
Predicted Effect probably benign
Transcript: ENSMUST00000106000
SMART Domains Protein: ENSMUSP00000101622
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163833
Predicted Effect probably benign
Transcript: ENSMUST00000164016
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164924
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably benign
Transcript: ENSMUST00000167491
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167900
Predicted Effect probably benign
Transcript: ENSMUST00000170879
SMART Domains Protein: ENSMUSP00000129946
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171994
Predicted Effect probably benign
Transcript: ENSMUST00000172215
SMART Domains Protein: ENSMUSP00000132793
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177840
SMART Domains Protein: ENSMUSP00000136331
Gene: ENSMUSG00000025510

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 248 1.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209698
Predicted Effect probably benign
Transcript: ENSMUST00000209892
Predicted Effect probably benign
Transcript: ENSMUST00000209988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210058
Predicted Effect probably benign
Transcript: ENSMUST00000211071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211564
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Cracr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Cracr2b APN 7 141465757 unclassified probably benign
IGL02092:Cracr2b APN 7 141464956 missense probably damaging 0.96
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0009:Cracr2b UTSW 7 141463759 missense probably damaging 1.00
R0324:Cracr2b UTSW 7 141463746 missense probably damaging 1.00
R0453:Cracr2b UTSW 7 141464263 missense probably damaging 0.96
R1386:Cracr2b UTSW 7 141463568 missense probably damaging 1.00
R2061:Cracr2b UTSW 7 141465280 missense probably damaging 0.96
R3605:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R3607:Cracr2b UTSW 7 141466146 missense possibly damaging 0.93
R4674:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R4675:Cracr2b UTSW 7 141463538 missense probably damaging 0.98
R5401:Cracr2b UTSW 7 141466223 makesense probably null
R6174:Cracr2b UTSW 7 141464836 missense probably damaging 1.00
R7127:Cracr2b UTSW 7 141465782 missense possibly damaging 0.73
R7132:Cracr2b UTSW 7 141463738 missense probably benign 0.30
R7303:Cracr2b UTSW 7 141463202 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCAATGGGGAGATAAACCCTCAC -3'
(R):5'- TGCGAGGACACCAACTTGAACTC -3'

Sequencing Primer
(F):5'- AATGGGCTGTGAGAACCCTC -3'
(R):5'- AGCAGAGTTCCCTGGACTTG -3'
Posted On2013-06-11