Incidental Mutation 'R0569:Olfr18'
ID46309
Institutional Source Beutler Lab
Gene Symbol Olfr18
Ensembl Gene ENSMUSG00000066896
Gene Nameolfactory receptor 18
SynonymsGA_x6K02T2PVTD-14054886-14053957, MOR145-1, MTPCR34
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20312152-20336094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20314579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 114 (I114F)
Ref Sequence ENSEMBL: ENSMUSP00000083664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086473] [ENSMUST00000212943]
Predicted Effect probably damaging
Transcript: ENSMUST00000086473
AA Change: I114F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083664
Gene: ENSMUSG00000066896
AA Change: I114F

DomainStartEndE-ValueType
Pfam:7tm_4 53 330 1.2e-54 PFAM
Pfam:7TM_GPCR_Srsx 57 234 3.2e-9 PFAM
Pfam:7tm_1 63 312 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212727
Predicted Effect probably damaging
Transcript: ENSMUST00000212943
AA Change: I106F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220241
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Olfr18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Olfr18 APN 9 20314719 missense probably damaging 1.00
IGL02412:Olfr18 APN 9 20314639 missense probably benign
IGL03288:Olfr18 APN 9 20335911 critical splice donor site probably null
IGL03395:Olfr18 APN 9 20314551 missense probably damaging 1.00
R0332:Olfr18 UTSW 9 20314056 missense probably benign 0.00
R0346:Olfr18 UTSW 9 20314411 missense probably benign 0.20
R0798:Olfr18 UTSW 9 20314199 nonsense probably null
R0865:Olfr18 UTSW 9 20314749 missense probably damaging 1.00
R1082:Olfr18 UTSW 9 20314469 missense possibly damaging 0.52
R1905:Olfr18 UTSW 9 20314846 missense probably benign
R4245:Olfr18 UTSW 9 20314333 missense possibly damaging 0.87
R5566:Olfr18 UTSW 9 20313969 missense probably benign
R6306:Olfr18 UTSW 9 20314446 missense probably benign 0.25
R6721:Olfr18 UTSW 9 20314280 missense probably benign 0.24
R6787:Olfr18 UTSW 9 20335925 missense probably benign
R6930:Olfr18 UTSW 9 20314099 missense probably damaging 1.00
R7196:Olfr18 UTSW 9 20314198 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTTCCCACCAGGTGATGGCATTC -3'
(R):5'- TCATGGGACTCTCAGATGACCTGC -3'

Sequencing Primer
(F):5'- CCACACTCTTGAAGTAGGTAAGTTG -3'
(R):5'- AGCTTCAGCCTATACTCTTTGGAC -3'
Posted On2013-06-11