Incidental Mutation 'R0569:Adcy1'
ID46315
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Nameadenylate cyclase 1
SynonymsI-AC, D11Bwg1392e, AC1
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0569 (G1)
Quality Score160
Status Validated
Chromosome11
Chromosomal Location7063489-7178506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7146514 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 634 (V634E)
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
Predicted Effect probably benign
Transcript: ENSMUST00000020706
AA Change: V634E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: V634E

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7137385 missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7064102 missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7169414 missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7167143 missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7100565 splice site probably benign
IGL01945:Adcy1 APN 11 7161891 missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7144737 missense probably benign 0.26
IGL02649:Adcy1 APN 11 7167156 missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7138279 splice site probably benign
IGL02813:Adcy1 APN 11 7146591 missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7079012 missense probably benign 0.19
IGL03116:Adcy1 APN 11 7150071 missense probably benign
IGL03119:Adcy1 APN 11 7109051 missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7167054 splice site probably benign
PIT4431001:Adcy1 UTSW 11 7064089 missense possibly damaging 0.93
PIT4520001:Adcy1 UTSW 11 7167133 missense probably damaging 1.00
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7149497 splice site probably benign
R0082:Adcy1 UTSW 11 7149497 splice site probably benign
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7149538 missense probably benign 0.08
R1055:Adcy1 UTSW 11 7109075 missense probably damaging 1.00
R1144:Adcy1 UTSW 11 7137400 missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7167054 splice site probably null
R1245:Adcy1 UTSW 11 7169410 splice site probably benign
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1823:Adcy1 UTSW 11 7161312 missense probably benign 0.23
R1953:Adcy1 UTSW 11 7078991 missense probably benign 0.01
R1957:Adcy1 UTSW 11 7161945 missense probably benign 0.00
R2029:Adcy1 UTSW 11 7139142 missense probably benign 0.10
R2051:Adcy1 UTSW 11 7161885 nonsense probably null
R2483:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3108:Adcy1 UTSW 11 7169453 missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3624:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R4082:Adcy1 UTSW 11 7064117 missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7063889 missense probably damaging 1.00
R4470:Adcy1 UTSW 11 7144804 missense probably benign 0.17
R4472:Adcy1 UTSW 11 7130369 missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7138336 missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7161298 missense probably benign 0.25
R5237:Adcy1 UTSW 11 7149553 missense probably benign 0.00
R5288:Adcy1 UTSW 11 7161351 missense probably benign 0.01
R5304:Adcy1 UTSW 11 7064198 missense probably benign 0.00
R5341:Adcy1 UTSW 11 7130375 missense probably damaging 0.99
R5379:Adcy1 UTSW 11 7146532 missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7139088 nonsense probably null
R5677:Adcy1 UTSW 11 7161914 missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7109020 missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7130300 missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7139095 missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7161337 missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7161367 missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7150884 missense possibly damaging 0.81
R6998:Adcy1 UTSW 11 7079026 missense probably damaging 1.00
X0027:Adcy1 UTSW 11 7161930 missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7150019 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AATTACCCAGGGACCTGTGGCAAG -3'
(R):5'- AGAAGGCTGCTCCCGAAACAAG -3'

Sequencing Primer
(F):5'- CAAGTGGATATTGGCAATGCTTCC -3'
(R):5'- TCTACTTGCCACTGAGAATCAAGG -3'
Posted On2013-06-11