Incidental Mutation 'R0569:Asgr2'
ID46317
Institutional Source Beutler Lab
Gene Symbol Asgr2
Ensembl Gene ENSMUSG00000040963
Gene Nameasialoglycoprotein receptor 2
SynonymsASGPR2, Asgr-2, Asgr
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70092644-70106187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70097877 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000099632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102572] [ENSMUST00000124721] [ENSMUST00000143772]
Predicted Effect probably benign
Transcript: ENSMUST00000102572
AA Change: Q132L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099632
Gene: ENSMUSG00000040963
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:Lectin_N 29 162 1.5e-58 PFAM
CLECT 170 294 3.51e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124721
AA Change: Q132L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000121189
Gene: ENSMUSG00000040963
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:Lectin_N 25 162 1e-69 PFAM
CLECT 170 226 1.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143772
AA Change: Q29L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136505
Gene: ENSMUSG00000040963
AA Change: Q29L

DomainStartEndE-ValueType
Pfam:Lectin_N 1 59 7.5e-27 PFAM
CLECT 67 191 3.51e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179757
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in reduced ASGR1 protein expression and deficiency in clearance of asialoorsomucoid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Asgr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Asgr2 APN 11 70105367 splice site probably benign
IGL01936:Asgr2 APN 11 70098051 critical splice acceptor site probably null
IGL02827:Asgr2 APN 11 70096897 missense probably benign 0.05
IGL03034:Asgr2 APN 11 70098263 missense probably damaging 0.99
R1240:Asgr2 UTSW 11 70096850 missense possibly damaging 0.81
R1748:Asgr2 UTSW 11 70096832 missense probably damaging 0.99
R1920:Asgr2 UTSW 11 70098297 missense possibly damaging 0.93
R3016:Asgr2 UTSW 11 70105409 missense probably damaging 0.97
R4293:Asgr2 UTSW 11 70098231 missense probably benign 0.43
R4423:Asgr2 UTSW 11 70105385 missense probably benign 0.44
R4988:Asgr2 UTSW 11 70097839 missense probably benign 0.05
R6224:Asgr2 UTSW 11 70098246 missense probably damaging 0.98
R6981:Asgr2 UTSW 11 70096810 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAATAGTTCAGCCAGAGGAACCCG -3'
(R):5'- GTGCTTCAGGTGAAAGAGCAATGTG -3'

Sequencing Primer
(F):5'- AAGGCTTCCGGCAATACG -3'
(R):5'- AATGGTCTAAGGGGCAAACAC -3'
Posted On2013-06-11