Incidental Mutation 'R0569:4833420G17Rik'
ID46324
Institutional Source Beutler Lab
Gene Symbol 4833420G17Rik
Ensembl Gene ENSMUSG00000062822
Gene NameRIKEN cDNA 4833420G17 gene
Synonyms
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location119462768-119486120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119484480 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 572 (I572M)
Ref Sequence ENSEMBL: ENSMUSP00000153079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026519] [ENSMUST00000099147] [ENSMUST00000099148] [ENSMUST00000176171] [ENSMUST00000223912] [ENSMUST00000224312] [ENSMUST00000225186] [ENSMUST00000225726]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026519
AA Change: I572M

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026519
Gene: ENSMUSG00000062822
AA Change: I572M

DomainStartEndE-ValueType
Pfam:DUF4524 9 154 5e-61 PFAM
Pfam:DUF4520 451 542 8.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099147
SMART Domains Protein: ENSMUSP00000096751
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099148
SMART Domains Protein: ENSMUSP00000096752
Gene: ENSMUSG00000074635

DomainStartEndE-ValueType
low complexity region 66 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176171
SMART Domains Protein: ENSMUSP00000135685
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 136 158 N/A INTRINSIC
transmembrane domain 202 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177361
SMART Domains Protein: ENSMUSP00000134785
Gene: ENSMUSG00000074634

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223912
Predicted Effect possibly damaging
Transcript: ENSMUST00000224312
AA Change: I572M

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000225186
AA Change: I572M

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000225726
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in 4833420G17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:4833420G17Rik APN 13 119466958 critical splice donor site probably null
IGL01555:4833420G17Rik APN 13 119473907 missense probably benign 0.10
IGL02395:4833420G17Rik APN 13 119480960 missense probably damaging 1.00
IGL02725:4833420G17Rik APN 13 119474909 missense possibly damaging 0.95
IGL02904:4833420G17Rik APN 13 119484454 missense probably damaging 1.00
IGL03126:4833420G17Rik APN 13 119481027 missense probably benign 0.23
R0410:4833420G17Rik UTSW 13 119469732 missense probably benign
R0437:4833420G17Rik UTSW 13 119470095 missense probably benign 0.35
R0513:4833420G17Rik UTSW 13 119469659 missense probably benign 0.13
R0788:4833420G17Rik UTSW 13 119473932 nonsense probably null
R1495:4833420G17Rik UTSW 13 119477820 missense probably benign 0.17
R1617:4833420G17Rik UTSW 13 119466937 missense probably damaging 1.00
R1905:4833420G17Rik UTSW 13 119469680 missense possibly damaging 0.92
R1914:4833420G17Rik UTSW 13 119485850 missense possibly damaging 0.90
R2169:4833420G17Rik UTSW 13 119485813 missense probably benign 0.09
R4238:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4240:4833420G17Rik UTSW 13 119466942 missense probably benign 0.00
R4295:4833420G17Rik UTSW 13 119469713 missense probably benign 0.02
R4469:4833420G17Rik UTSW 13 119469809 missense probably damaging 1.00
R4643:4833420G17Rik UTSW 13 119474860 missense probably damaging 0.97
R4964:4833420G17Rik UTSW 13 119474221 intron probably benign
R4966:4833420G17Rik UTSW 13 119474221 intron probably benign
R5093:4833420G17Rik UTSW 13 119474037 utr 3 prime probably benign
R5384:4833420G17Rik UTSW 13 119469960 missense probably benign 0.01
R6255:4833420G17Rik UTSW 13 119466123 missense possibly damaging 0.95
R6491:4833420G17Rik UTSW 13 119475972 missense probably damaging 1.00
R6564:4833420G17Rik UTSW 13 119486077 unclassified probably null
R7023:4833420G17Rik UTSW 13 119473907 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TCAAGCTGTGGTATTTGTATAGCGTTCC -3'
(R):5'- AGAGACTTTAACCCTAGCTCACCATTCT -3'

Sequencing Primer
(F):5'- TGTATAGCGTTCCGACTCG -3'
(R):5'- TCACCATTCTTTACCCAATTCAAAC -3'
Posted On2013-06-11