Incidental Mutation 'R0569:Enox1'
ID46325
Institutional Source Beutler Lab
Gene Symbol Enox1
Ensembl Gene ENSMUSG00000022012
Gene Nameecto-NOX disulfide-thiol exchanger 1
SynonymsD230005D02Rik
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R0569 (G1)
Quality Score223
Status Validated
Chromosome14
Chromosomal Location77156763-77721760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77637677 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 441 (D441E)
Ref Sequence ENSEMBL: ENSMUSP00000022589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022589] [ENSMUST00000227662] [ENSMUST00000227831]
Predicted Effect probably damaging
Transcript: ENSMUST00000022589
AA Change: D441E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022589
Gene: ENSMUSG00000022012
AA Change: D441E

DomainStartEndE-ValueType
low complexity region 95 105 N/A INTRINSIC
RRM 143 209 2.41e-8 SMART
low complexity region 233 251 N/A INTRINSIC
coiled coil region 307 342 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
coiled coil region 425 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227098
Predicted Effect possibly damaging
Transcript: ENSMUST00000227662
AA Change: D460E

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000227831
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in plasma membrane electron transport pathways. The encoded protein has both a hydroquinone (NADH) oxidase activity and a protein disulfide-thiol interchange activity. The two activities cycle with a periodicity of 24 minutes, with one activity being at its peak when the other is at its lowest. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcat C T 15: 83,549,248 R198H probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Enox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Enox1 APN 14 77582404 missense possibly damaging 0.63
IGL01376:Enox1 APN 14 77251843 intron probably benign
IGL01509:Enox1 APN 14 77699273 missense probably damaging 1.00
IGL01684:Enox1 APN 14 77579093 missense possibly damaging 0.81
IGL01874:Enox1 APN 14 77579162 missense probably damaging 1.00
IGL03324:Enox1 APN 14 77615485 missense probably damaging 1.00
soft UTSW 14 77486017 intron probably benign
R0037:Enox1 UTSW 14 77699310 splice site probably benign
R0112:Enox1 UTSW 14 77699198 missense possibly damaging 0.77
R0543:Enox1 UTSW 14 77506959 splice site probably benign
R0708:Enox1 UTSW 14 77592912 missense probably benign 0.28
R0811:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R0812:Enox1 UTSW 14 77582436 missense probably damaging 0.99
R1417:Enox1 UTSW 14 77486005 intron probably benign
R1654:Enox1 UTSW 14 77611374 missense possibly damaging 0.87
R1678:Enox1 UTSW 14 77577656 missense probably benign 0.00
R1817:Enox1 UTSW 14 77615475 missense possibly damaging 0.84
R1976:Enox1 UTSW 14 77668793 missense probably benign
R2520:Enox1 UTSW 14 77582399 missense probably damaging 0.99
R3880:Enox1 UTSW 14 77611386 missense possibly damaging 0.49
R4096:Enox1 UTSW 14 77577720 missense probably damaging 0.99
R4885:Enox1 UTSW 14 77720850 missense probably damaging 1.00
R4998:Enox1 UTSW 14 77501435 intron probably benign
R5110:Enox1 UTSW 14 77707687 critical splice donor site probably null
R5341:Enox1 UTSW 14 77577656 missense possibly damaging 0.94
R5469:Enox1 UTSW 14 77592974 missense probably benign 0.00
R5596:Enox1 UTSW 14 77579053 missense probably benign 0.42
R5833:Enox1 UTSW 14 77506939 missense probably benign 0.01
R5892:Enox1 UTSW 14 77486017 intron probably benign
R6174:Enox1 UTSW 14 77508187 missense possibly damaging 0.93
R6267:Enox1 UTSW 14 77577764 missense probably damaging 1.00
R6867:Enox1 UTSW 14 77699299 critical splice donor site probably null
R7069:Enox1 UTSW 14 77611324 missense probably damaging 0.99
R7219:Enox1 UTSW 14 77720844 missense probably benign 0.15
R7316:Enox1 UTSW 14 77720858 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAAGAACCCTGAGGCTTGGCTATC -3'
(R):5'- GCATGGCTTTGTCCAGCTTTCAAC -3'

Sequencing Primer
(F):5'- GCTATCAGGGTTTAACGTCTGAG -3'
(R):5'- TAGATGTCCCAAGAGTCTCCG -3'
Posted On2013-06-11