Incidental Mutation 'R0569:Mcat'
ID46327
Institutional Source Beutler Lab
Gene Symbol Mcat
Ensembl Gene ENSMUSG00000048755
Gene Namemalonyl CoA:ACP acyltransferase (mitochondrial)
Synonyms
MMRRC Submission 038760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R0569 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83546797-83563787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83549248 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 198 (R198H)
Ref Sequence ENSEMBL: ENSMUSP00000051569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016902] [ENSMUST00000061882] [ENSMUST00000229724] [ENSMUST00000229964] [ENSMUST00000230912]
Predicted Effect probably benign
Transcript: ENSMUST00000016902
SMART Domains Protein: ENSMUSP00000016902
Gene: ENSMUSG00000016758

DomainStartEndE-ValueType
Pfam:bcl-2I13 1 149 1.5e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061882
AA Change: R198H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000051569
Gene: ENSMUSG00000048755
AA Change: R198H

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl_transf_1 62 342 5.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229177
Predicted Effect probably benign
Transcript: ENSMUST00000229724
AA Change: R35H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230094
Predicted Effect probably benign
Transcript: ENSMUST00000230672
Predicted Effect probably benign
Transcript: ENSMUST00000230851
Predicted Effect probably benign
Transcript: ENSMUST00000230912
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found exclusively in the mitochondrion, where it catalyzes the transfer of a malonyl group from malonyl-CoA to the mitochondrial acyl carrier protein. The encoded protein may be part of a fatty acid synthase complex that is more like the type II prokaryotic and plastid complexes rather than the type I human cytosolic complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a conditional allele activated ubiquitously consume more food, fail to gain weight, are less physically active, and suffer from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,484,480 I572M possibly damaging Het
4930447A16Rik T C 15: 37,425,619 M1T probably null Het
4930590J08Rik C A 6: 91,942,578 C739* probably null Het
Adcy1 T A 11: 7,146,514 V634E probably benign Het
Ankfy1 T A 11: 72,753,608 H710Q possibly damaging Het
Ankrd60 C T 2: 173,571,066 V90M probably damaging Het
Asgr2 A T 11: 70,097,877 Q132L probably benign Het
Cchcr1 T A 17: 35,528,968 probably null Het
Ces1h T C 8: 93,352,146 K523E unknown Het
Clec3a G T 8: 114,425,736 G161C probably damaging Het
Cracr2b G A 7: 141,464,935 probably benign Het
Cyp2b10 A T 7: 25,897,735 L17F probably damaging Het
Dhx29 T A 13: 112,948,214 N655K probably benign Het
Dst C A 1: 34,293,427 L4748I probably damaging Het
Eif2b5 G C 16: 20,502,553 L285F probably benign Het
Enox1 T A 14: 77,637,677 D441E probably damaging Het
Fam110a T C 2: 151,970,484 E122G probably damaging Het
Fam161b T A 12: 84,348,639 E510V probably damaging Het
Gabrd T C 4: 155,385,423 Y443C probably damaging Het
Gcn1l1 T G 5: 115,595,059 S1052A probably benign Het
Gnptab A G 10: 88,428,557 E279G possibly damaging Het
Hoxa6 T A 6: 52,208,183 probably null Het
Ibtk T A 9: 85,708,181 probably benign Het
Il6ra A T 3: 89,877,842 probably null Het
Iqgap3 C T 3: 88,090,725 probably benign Het
Kcnk2 A C 1: 189,339,801 L110R probably damaging Het
Knl1 T A 2: 119,097,435 V1919D possibly damaging Het
Lrp1b A T 2: 40,889,239 L2597Q probably benign Het
Magi3 A G 3: 104,016,042 S1120P probably benign Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mnd1 A G 3: 84,104,979 V141A probably benign Het
Morc1 T C 16: 48,587,122 L667P probably benign Het
Mrps6 A G 16: 92,111,920 K125E possibly damaging Het
Mst1 T C 9: 108,082,301 F262S probably damaging Het
Olfr1052 T G 2: 86,298,597 I260M probably damaging Het
Olfr18 T A 9: 20,314,579 I114F probably damaging Het
Pbsn C G X: 77,853,440 G15A possibly damaging Het
Pcnx T C 12: 81,992,030 I2023T probably benign Het
Pds5a T G 5: 65,656,401 N247T probably damaging Het
Peak1 T C 9: 56,260,089 Y185C probably damaging Het
Phkb T A 8: 86,017,402 I560N probably damaging Het
Plekhn1 T C 4: 156,225,201 I160V probably damaging Het
Rabgap1 T G 2: 37,489,717 probably benign Het
Rdh10 T G 1: 16,129,293 V241G probably damaging Het
Selenow A T 7: 15,920,117 C37S probably benign Het
Sema6a A T 18: 47,270,805 probably null Het
Slc12a3 T C 8: 94,330,525 probably null Het
Slc22a21 T G 11: 53,951,810 M498L probably benign Het
Spink5 A T 18: 43,989,419 N317I probably damaging Het
Srek1 A G 13: 103,748,862 probably benign Het
Syt11 A G 3: 88,747,923 V357A probably benign Het
Tcof1 T A 18: 60,829,035 K707N possibly damaging Het
Tfip11 C T 5: 112,328,094 R42C probably damaging Het
Trim39 T C 17: 36,263,731 K260E probably benign Het
Ttn T C 2: 76,723,319 T22658A possibly damaging Het
Unc45b C T 11: 82,936,812 probably benign Het
Vmn1r236 A G 17: 21,286,910 I97V probably benign Het
Vps13c T C 9: 67,973,719 V657A probably damaging Het
Zkscan2 A G 7: 123,498,675 V166A probably benign Het
Other mutations in Mcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1497:Mcat UTSW 15 83549252 nonsense probably null
R5518:Mcat UTSW 15 83547674 unclassified probably null
R5909:Mcat UTSW 15 83547915 missense probably benign 0.20
R6508:Mcat UTSW 15 83549251 missense probably benign
R6582:Mcat UTSW 15 83549182 missense probably benign 0.00
R6964:Mcat UTSW 15 83547931 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGCAATATCCTGGCTTCTGCTTC -3'
(R):5'- CCCTGAATGACAGCTTACCTTCCAC -3'

Sequencing Primer
(F):5'- GTTCTCCAGATGATACTCAGCAAG -3'
(R):5'- CACTTCACAGTTAGATTTCCAAACG -3'
Posted On2013-06-11