Incidental Mutation 'R0570:Rassf1'
ID46389
Institutional Source Beutler Lab
Gene Symbol Rassf1
Ensembl Gene ENSMUSG00000010067
Gene NameRas association (RalGDS/AF-6) domain family member 1
Synonyms123F protein, NORE2A, Rassf1A, Rassf1B, Rassf1C, RDA32, REH3P21
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107551555-107562267 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107557966 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 224 (T224I)
Ref Sequence ENSEMBL: ENSMUSP00000113252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010211] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000156198]
Predicted Effect probably damaging
Transcript: ENSMUST00000010211
AA Change: T150I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010211
Gene: ENSMUSG00000010067
AA Change: T150I

DomainStartEndE-ValueType
low complexity region 98 115 N/A INTRINSIC
RA 124 218 6.26e-24 SMART
PDB:4LGD|H 219 264 3e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000093786
AA Change: T220I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067
AA Change: T220I

DomainStartEndE-ValueType
C1 44 101 4.7e-7 SMART
low complexity region 168 185 N/A INTRINSIC
RA 194 288 6.26e-24 SMART
PDB:4LGD|H 289 334 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121635
SMART Domains Protein: ENSMUSP00000113037
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
RA 76 170 6.26e-24 SMART
PDB:4LGD|H 171 216 1e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000122225
AA Change: T224I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067
AA Change: T224I

DomainStartEndE-ValueType
C1 44 105 1.92e-3 SMART
low complexity region 172 189 N/A INTRINSIC
RA 198 292 6.26e-24 SMART
Pfam:Nore1-SARAH 299 338 4.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144129
Predicted Effect probably benign
Transcript: ENSMUST00000156198
SMART Domains Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

DomainStartEndE-ValueType
Blast:C1 44 83 6e-24 BLAST
SCOP:d1ptq__ 52 82 5e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191832
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous and heterozygous null mice display increased tumor incidence, especially of lung adenomas and lymphomas, and increased sensitivity to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Rassf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rassf1 APN 9 107558311 splice site probably benign
R1548:Rassf1 UTSW 9 107551846 missense probably benign 0.00
R1826:Rassf1 UTSW 9 107558193 missense probably damaging 0.99
R2312:Rassf1 UTSW 9 107557550 missense probably damaging 1.00
R2899:Rassf1 UTSW 9 107554194 missense probably null 0.00
R3902:Rassf1 UTSW 9 107554840 missense probably damaging 1.00
R4705:Rassf1 UTSW 9 107557867 missense probably benign 0.04
R5491:Rassf1 UTSW 9 107561415 missense possibly damaging 0.95
R5733:Rassf1 UTSW 9 107558014 missense probably damaging 1.00
R5863:Rassf1 UTSW 9 107557824 missense probably damaging 1.00
R5986:Rassf1 UTSW 9 107551822 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TAGTGCGTCCTGTTTCAGTGCC -3'
(R):5'- TGCAAGAAGCCGCAGCTTCAAG -3'

Sequencing Primer
(F):5'- TCAGTGCCTTCCAGCAAG -3'
(R):5'- TTAAAGACAGACTCAGGTGGCTC -3'
Posted On2013-06-11