Incidental Mutation 'R0570:Fhod3'
ID46419
Institutional Source Beutler Lab
Gene Symbol Fhod3
Ensembl Gene ENSMUSG00000034295
Gene Nameformin homology 2 domain containing 3
SynonymsA930009H06Rik
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24709445-25133500 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25112583 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1230 (I1230T)
Ref Sequence ENSEMBL: ENSMUSP00000041361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037097]
Predicted Effect probably benign
Transcript: ENSMUST00000037097
AA Change: I1230T

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041361
Gene: ENSMUSG00000034295
AA Change: I1230T

DomainStartEndE-ValueType
PDB:3DAD|B 1 327 1e-127 PDB
Blast:Drf_GBD 73 204 3e-60 BLAST
Blast:FH2 219 306 4e-25 BLAST
low complexity region 399 420 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 553 583 N/A INTRINSIC
coiled coil region 598 632 N/A INTRINSIC
low complexity region 674 701 N/A INTRINSIC
low complexity region 753 763 N/A INTRINSIC
low complexity region 784 793 N/A INTRINSIC
Blast:FH2 879 918 1e-9 BLAST
Blast:FH2 931 964 1e-7 BLAST
low complexity region 965 980 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
FH2 1039 1492 3.96e-72 SMART
Blast:FH2 1506 1570 9e-11 BLAST
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the diaphanous-related formins (DRF), and contains multiple domains, including GBD (GTPase-binding domain), DID (diaphanous inhibitory domain), FH1 (formin homology 1), FH2 (formin homology 2), and DAD (diaphanous auto-regulatory domain) domains. This protein is thought to play a role in actin filament polymerization in cardiomyocytes. Mutations in this gene have been associated with dilated cardiomyopathy (DCM), characterized by dilation of the ventricular chamber, leading to impairment of systolic pump function and subsequent heart failure. Increased levels of the protein encoded by this gene have been observed in individuals with hypertrophic cardiomyopathy (HCM). Alternative splicing results in multiple transcript variants encoding different isoforms. A muscle-specific isoform has been shown to possess a casein kinase 2 (CK2) phosphorylation site at the C-terminal end of the FH2 domain. Phosphorylation of this site alters its interaction with sequestosome 1 (SQSTM1), and targets this isoform to myofibrils, while other isoforms form cytoplasmic aggregates. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out reporter allele exhibit abnormal premyofibril maturation, impaired heart development, pericardial effusion and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Fhod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Fhod3 APN 18 24994540 missense probably damaging 1.00
IGL01139:Fhod3 APN 18 25066344 missense probably benign 0.00
IGL01293:Fhod3 APN 18 25020652 splice site probably benign
IGL01313:Fhod3 APN 18 25020720 missense probably damaging 1.00
IGL01524:Fhod3 APN 18 25130602 missense probably damaging 0.99
IGL01568:Fhod3 APN 18 25120162 missense probably benign 0.04
IGL01586:Fhod3 APN 18 25090747 missense probably damaging 0.98
IGL01622:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01623:Fhod3 APN 18 25022867 missense probably benign 0.35
IGL01640:Fhod3 APN 18 25115793 missense probably benign 0.13
IGL01860:Fhod3 APN 18 24897681 missense probably damaging 0.99
IGL01860:Fhod3 APN 18 24903948 missense probably damaging 1.00
IGL02192:Fhod3 APN 18 25056358 missense probably damaging 1.00
IGL02390:Fhod3 APN 18 25066275 missense probably benign 0.15
IGL02550:Fhod3 APN 18 25022960 missense probably benign 0.00
IGL02987:Fhod3 APN 18 25113553 missense possibly damaging 0.87
R0328:Fhod3 UTSW 18 25113600 missense probably benign 0.01
R0362:Fhod3 UTSW 18 25090076 nonsense probably null
R0373:Fhod3 UTSW 18 25090104 missense possibly damaging 0.93
R0483:Fhod3 UTSW 18 24709616 missense probably damaging 1.00
R0617:Fhod3 UTSW 18 25112679 splice site probably benign
R0834:Fhod3 UTSW 18 25115805 nonsense probably null
R0836:Fhod3 UTSW 18 25066218 missense probably damaging 1.00
R1132:Fhod3 UTSW 18 25020665 small deletion probably benign
R1157:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1158:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1160:Fhod3 UTSW 18 24985236 missense probably damaging 1.00
R1381:Fhod3 UTSW 18 25090471 missense probably damaging 1.00
R1533:Fhod3 UTSW 18 25115864 missense probably damaging 1.00
R1621:Fhod3 UTSW 18 25022867 missense probably benign 0.35
R1748:Fhod3 UTSW 18 24770493 nonsense probably null
R1757:Fhod3 UTSW 18 25066278 missense possibly damaging 0.78
R1758:Fhod3 UTSW 18 25120310 missense possibly damaging 0.88
R1872:Fhod3 UTSW 18 25130610 missense probably damaging 1.00
R1911:Fhod3 UTSW 18 25112586 missense possibly damaging 0.81
R1917:Fhod3 UTSW 18 24989965 splice site probably benign
R1917:Fhod3 UTSW 18 25085601 missense probably benign 0.27
R1934:Fhod3 UTSW 18 25090278 missense probably benign 0.35
R1958:Fhod3 UTSW 18 25090465 missense probably damaging 1.00
R1997:Fhod3 UTSW 18 25090416 missense possibly damaging 0.79
R3618:Fhod3 UTSW 18 25020665 small deletion probably benign
R3709:Fhod3 UTSW 18 25090758 missense probably damaging 1.00
R3937:Fhod3 UTSW 18 25090761 missense probably benign 0.44
R4246:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4248:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4249:Fhod3 UTSW 18 24990066 missense probably null 1.00
R4497:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4498:Fhod3 UTSW 18 25110239 critical splice donor site probably null
R4532:Fhod3 UTSW 18 25110221 missense probably damaging 1.00
R4596:Fhod3 UTSW 18 25115718 missense probably benign 0.01
R4628:Fhod3 UTSW 18 25120129 missense possibly damaging 0.94
R4667:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4668:Fhod3 UTSW 18 25066338 missense probably benign 0.00
R4734:Fhod3 UTSW 18 25028135 missense probably benign 0.00
R4753:Fhod3 UTSW 18 25090325 missense possibly damaging 0.80
R4796:Fhod3 UTSW 18 24985301 missense probably damaging 1.00
R4832:Fhod3 UTSW 18 25090248 missense probably benign 0.00
R5338:Fhod3 UTSW 18 25028081 missense probably damaging 0.96
R5832:Fhod3 UTSW 18 25090695 missense probably damaging 1.00
R5863:Fhod3 UTSW 18 25125753 missense probably benign 0.25
R6362:Fhod3 UTSW 18 24754255 missense probably benign 0.00
R6414:Fhod3 UTSW 18 25090878 missense possibly damaging 0.64
R7099:Fhod3 UTSW 18 25090162 missense probably benign
R7172:Fhod3 UTSW 18 25085546 missense probably damaging 1.00
R7190:Fhod3 UTSW 18 25090755 missense probably damaging 1.00
R7241:Fhod3 UTSW 18 25060352 missense probably damaging 1.00
R7294:Fhod3 UTSW 18 25132980 missense probably damaging 1.00
R7348:Fhod3 UTSW 18 25090467 missense possibly damaging 0.80
R7432:Fhod3 UTSW 18 25001909 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGAGAGCAAGCAGTCTTCACTCC -3'
(R):5'- GTACAGCTCCATCAGTATGCGACG -3'

Sequencing Primer
(F):5'- TATCTAGGACCAAATGCCTGTC -3'
(R):5'- TCAGTATGCGACGGCAGAG -3'
Posted On2013-06-11