Incidental Mutation 'R0570:Smad2'
ID46421
Institutional Source Beutler Lab
Gene Symbol Smad2
Ensembl Gene ENSMUSG00000024563
Gene NameSMAD family member 2
SynonymsSmad 2, Madr2, 7120426M23Rik, Madh2
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location76241580-76305731 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 76289179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]
Predicted Effect probably benign
Transcript: ENSMUST00000025453
SMART Domains Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091831
SMART Domains Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 1e-10 BLAST
DWB 242 413 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113930
SMART Domains Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 9e-11 BLAST
DWB 242 408 4.38e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165084
SMART Domains Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 144 7.85e-67 SMART
PDB:1KHX|A 166 204 3e-19 PDB
SCOP:d1khxa_ 190 204 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168423
SMART Domains Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171256
SMART Domains Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWA 182 213 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172198
SMART Domains Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
Pfam:MH2 28 58 1.8e-10 PFAM
Meta Mutation Damage Score 0.1196 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Myrf A G 19: 10,211,797 S857P probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Smad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Smad2 APN 18 76298495 missense possibly damaging 0.94
IGL00978:Smad2 APN 18 76299775 splice site probably benign
IGL01295:Smad2 APN 18 76302430 missense probably benign 0.05
IGL01887:Smad2 APN 18 76299894 missense probably damaging 1.00
IGL01960:Smad2 APN 18 76262484 intron probably benign
IGL02881:Smad2 APN 18 76299780 splice site probably null
IGL02977:Smad2 APN 18 76289164 missense possibly damaging 0.64
R0333:Smad2 UTSW 18 76262621 missense probably damaging 1.00
R0391:Smad2 UTSW 18 76289037 critical splice acceptor site probably null
R0523:Smad2 UTSW 18 76262552 missense probably benign
R0624:Smad2 UTSW 18 76299993 missense probably damaging 1.00
R1573:Smad2 UTSW 18 76262586 missense possibly damaging 0.89
R1953:Smad2 UTSW 18 76262705 missense possibly damaging 0.90
R2132:Smad2 UTSW 18 76288084 nonsense probably null
R2213:Smad2 UTSW 18 76304626 missense probably damaging 1.00
R3021:Smad2 UTSW 18 76262632 missense probably damaging 1.00
R3917:Smad2 UTSW 18 76287937 missense probably benign 0.42
R4503:Smad2 UTSW 18 76302592 missense probably benign 0.23
R5253:Smad2 UTSW 18 76288053 missense probably damaging 1.00
R5290:Smad2 UTSW 18 76262724 missense probably damaging 1.00
R5891:Smad2 UTSW 18 76299975 missense probably damaging 1.00
R6294:Smad2 UTSW 18 76289162 missense probably benign 0.31
R6879:Smad2 UTSW 18 76262654 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GAAAGGTGAGCTACTGCCTTCTCC -3'
(R):5'- AGACCATACACTATGCCTACGCTCTG -3'

Sequencing Primer
(F):5'- CTTCTCCCTGTGAGAGCGTG -3'
(R):5'- AGCTGTCTCTACTTCAAGAGC -3'
Posted On2013-06-11