Incidental Mutation 'R0570:Myrf'
ID46423
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission 038761-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock #R0570 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10211797 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 857 (S857P)
Ref Sequence ENSEMBL: ENSMUSP00000140871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040372] [ENSMUST00000088013] [ENSMUST00000166412] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably benign
Transcript: ENSMUST00000040372
SMART Domains Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 3 79 3.3e-47 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088013
AA Change: S1058P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: S1058P

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153854
Predicted Effect probably benign
Transcript: ENSMUST00000166412
SMART Domains Protein: ENSMUSP00000128883
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 1 74 2.1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000186056
AA Change: S857P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: S857P

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186854
AA Change: S396P
Predicted Effect probably damaging
Transcript: ENSMUST00000189897
AA Change: S1032P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: S1032P

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik C A 8: 84,003,104 probably benign Het
Aadacl3 C T 4: 144,463,560 W57* probably null Het
Abca2 G T 2: 25,447,405 probably null Het
Abca3 A G 17: 24,374,399 I257V probably benign Het
Adamts2 A G 11: 50,776,136 D420G probably damaging Het
Adamts5 A G 16: 85,899,247 F341L probably damaging Het
Ahnak T A 19: 9,013,698 D4115E probably damaging Het
Arhgap20 T C 9: 51,840,451 S365P possibly damaging Het
Atrn G A 2: 130,980,134 V916I probably benign Het
Blmh T C 11: 76,965,825 V82A probably damaging Het
C1ra A T 6: 124,513,705 Y19F probably benign Het
Cactin A G 10: 81,323,233 E306G probably damaging Het
Celsr1 C T 15: 85,903,365 R2724Q probably benign Het
Clca4b T C 3: 144,925,349 E250G probably benign Het
Col17a1 A T 19: 47,665,878 S647T possibly damaging Het
Cope T A 8: 70,306,531 D74E probably damaging Het
Dsg1c T C 18: 20,270,378 I198T probably damaging Het
Elfn2 T C 15: 78,673,234 N371S probably damaging Het
Elmo2 G T 2: 165,304,919 A246D probably benign Het
Ewsr1 A T 11: 5,085,935 M187K possibly damaging Het
Faap100 A T 11: 120,374,288 S587R possibly damaging Het
Fam234b C T 6: 135,209,249 S85L probably benign Het
Fanca A T 8: 123,306,430 S292R probably benign Het
Fanci G A 7: 79,443,963 C1021Y probably damaging Het
Fhod3 T C 18: 25,112,583 I1230T probably benign Het
Fmo5 T C 3: 97,629,140 L27S probably damaging Het
Fmo9 A G 1: 166,674,462 V147A probably null Het
Fnbp4 A G 2: 90,752,957 Y309C probably damaging Het
Foxb1 T C 9: 69,759,562 T229A probably benign Het
Gapvd1 A G 2: 34,728,540 Y274H probably damaging Het
Gbp8 T C 5: 105,017,675 probably null Het
Gcn1l1 T A 5: 115,592,421 L888Q probably damaging Het
Gm17490 T C 2: 11,625,649 probably benign Het
Gtf2ird2 T A 5: 134,208,944 probably null Het
H2-Q1 A G 17: 35,321,397 T153A possibly damaging Het
Ina A C 19: 47,023,499 E452A probably benign Het
Kars A G 8: 111,994,862 probably null Het
Kif1c A G 11: 70,704,465 E124G probably damaging Het
Lpin3 T C 2: 160,904,024 probably benign Het
Lrp1 A T 10: 127,555,009 C3006* probably null Het
Lyst T C 13: 13,709,386 L2953P probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Melk T C 4: 44,308,906 Y88H probably damaging Het
Nos2 A G 11: 78,935,361 I153M possibly damaging Het
Olfr732 T G 14: 50,281,913 L113F probably benign Het
Otof A G 5: 30,371,881 probably benign Het
Patl2 A G 2: 122,125,308 V249A probably damaging Het
Pcgf5 A G 19: 36,412,180 Y19C probably benign Het
Pcnt A T 10: 76,412,107 V951E probably damaging Het
Pcolce2 T C 9: 95,638,657 V29A probably benign Het
Pdgfrb A T 18: 61,077,703 M761L probably benign Het
Pi16 A T 17: 29,319,215 M1L possibly damaging Het
Pkd2 T A 5: 104,455,605 probably benign Het
Plcb2 A G 2: 118,717,325 W474R probably benign Het
Psapl1 A G 5: 36,204,280 D72G possibly damaging Het
Ptpn5 T A 7: 47,078,933 probably benign Het
Ptprg A G 14: 12,215,896 E1115G probably damaging Het
Rassf1 C T 9: 107,557,966 T224I probably damaging Het
Rbpms2 T A 9: 65,659,194 C168* probably null Het
Rhag A G 17: 40,828,913 probably benign Het
Rhebl1 C T 15: 98,881,153 V17I probably benign Het
Rnf130 A T 11: 50,095,876 D349V possibly damaging Het
Rprd1a A G 18: 24,509,895 L60P probably damaging Het
Rspry1 T C 8: 94,629,792 I25T probably damaging Het
Ruvbl2 C T 7: 45,422,197 V421M probably damaging Het
Sap30 T C 8: 57,482,966 N209D possibly damaging Het
Sfswap T C 5: 129,503,978 probably benign Het
Slc1a2 G A 2: 102,756,007 V319M probably damaging Het
Smad2 T C 18: 76,289,179 probably benign Het
Spdya T C 17: 71,562,590 probably null Het
Stk39 G A 2: 68,410,048 T113M probably damaging Het
Tanc1 A G 2: 59,796,038 probably benign Het
Tas2r122 T C 6: 132,711,811 K40E probably damaging Het
Tph2 G T 10: 115,174,134 probably benign Het
Trip12 G A 1: 84,751,548 S1083F probably damaging Het
Tsc2 A T 17: 24,626,727 C206S probably damaging Het
Tsc22d4 A G 5: 137,762,419 Q34R possibly damaging Het
Uroc1 G T 6: 90,338,564 M142I possibly damaging Het
Uso1 T C 5: 92,199,823 S766P probably benign Het
Usp21 G A 1: 171,283,746 probably benign Het
Usp48 T A 4: 137,633,126 I658K possibly damaging Het
Vmn1r206 T C 13: 22,620,413 H208R probably damaging Het
Vmn2r109 C T 17: 20,540,675 A807T probably damaging Het
Zfp329 A T 7: 12,810,452 C382S probably damaging Het
Zfp341 A G 2: 154,646,068 E817G probably benign Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAAGACTGACAAGCACGCC -3'
(R):5'- ACTGTGGGAGAGGTTTCCTCCATC -3'

Sequencing Primer
(F):5'- TGTCCCAGCAGACATGCTC -3'
(R):5'- GAGAGGTTTCCTCCATCCCAAG -3'
Posted On2013-06-11