Incidental Mutation 'R0571:Drd5'
ID46447
Institutional Source Beutler Lab
Gene Symbol Drd5
Ensembl Gene ENSMUSG00000039358
Gene Namedopamine receptor D5
SynonymsD5R, Gpcr1, Drd1b, Drd-5, DRD1b
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0571 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38319367-38322518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38319927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 88 (V88M)
Ref Sequence ENSEMBL: ENSMUSP00000039691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041646]
Predicted Effect probably damaging
Transcript: ENSMUST00000041646
AA Change: V88M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039691
Gene: ENSMUSG00000039358
AA Change: V88M

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 47 177 5.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 49 179 1e-7 PFAM
Pfam:7tm_1 55 354 1.5e-74 PFAM
Pfam:7TM_GPCR_Srsx 210 368 2.4e-6 PFAM
low complexity region 419 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181240
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop hypertension and exhibit elevated blood pressure caused by increased sympathetic tone. Mice homozygous for another knock-out allele exhibit increased methamphetamine-induced ambulatory activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
D130052B06Rik G A 11: 33,623,922 R173H probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in Drd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Drd5 APN 5 38319781 missense probably benign 0.25
PIT4305001:Drd5 UTSW 5 38320584 missense probably damaging 1.00
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R1507:Drd5 UTSW 5 38320722 missense probably damaging 1.00
R1663:Drd5 UTSW 5 38320855 missense probably benign 0.02
R1777:Drd5 UTSW 5 38320161 missense probably damaging 1.00
R1932:Drd5 UTSW 5 38319976 missense probably benign 0.14
R1986:Drd5 UTSW 5 38320113 missense probably damaging 0.99
R2047:Drd5 UTSW 5 38320336 missense probably damaging 1.00
R3875:Drd5 UTSW 5 38319814 missense possibly damaging 0.84
R5033:Drd5 UTSW 5 38320201 missense probably damaging 1.00
R5201:Drd5 UTSW 5 38320023 missense probably damaging 0.96
R5255:Drd5 UTSW 5 38319967 missense probably damaging 1.00
R5393:Drd5 UTSW 5 38320905 missense probably benign
R5639:Drd5 UTSW 5 38319835 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTCTGCGTTTCTACGACTCAGAACC -3'
(R):5'- AGGGTCTGGAAATAGCCCAGTACC -3'

Sequencing Primer
(F):5'- AAGTTGGGATCGCACGC -3'
(R):5'- CGGTCCACGCTGATGATAC -3'
Posted On2013-06-11