Mutagenetix > Incidental Mutation

Incidental Mutation 'R0573:Trip11'

46548

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik

MMRRC Submission

038763-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0573 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101800304-101879463 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101853119 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 491 (I491T)

Ref Sequence

ENSEMBL: ENSMUSP00000135669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

AlphaFold

E9Q512

Predicted Effect

probably benign
Transcript: ENSMUST00000021605
AA Change: I492T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: I492T

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177183
AA Change: I207T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: I207T

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536
AA Change: I491T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188
AA Change: I491T

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.5%

Validation Efficiency

97% (60/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	A	T	12: 113,455,278 (GRCm39)	K698N	possibly damaging	Het
Adcy8	A	T	15: 64,694,044 (GRCm39)	V411D	probably damaging	Het
Arfgef3	T	A	10: 18,475,036 (GRCm39)	E1550V	probably damaging	Het
Asb3	T	A	11: 31,011,406 (GRCm39)	I306K	probably damaging	Het
Asic4	T	A	1: 75,445,746 (GRCm39)		probably benign	Het
Basp1	G	T	15: 25,364,948 (GRCm39)	D16E	unknown	Het
Cbll1	A	T	12: 31,540,539 (GRCm39)	I123N	probably damaging	Het
Ccdc141	A	T	2: 76,869,837 (GRCm39)	H889Q	probably benign	Het
Ccdc65	T	C	15: 98,618,930 (GRCm39)	V303A	probably benign	Het
Ceacam20	T	A	7: 19,720,593 (GRCm39)	M60K	probably damaging	Het
Chd9	T	A	8: 91,725,223 (GRCm39)	V711D	probably damaging	Het
Clcn1	T	A	6: 42,289,979 (GRCm39)		probably null	Het
Col16a1	A	T	4: 129,962,268 (GRCm39)		probably benign	Het
Col4a3	C	A	1: 82,694,084 (GRCm39)	P1568Q	possibly damaging	Het
Colec12	C	A	18: 9,858,650 (GRCm39)	P478T	probably damaging	Het
Dchs1	T	C	7: 105,407,985 (GRCm39)	H1949R	probably damaging	Het
Dgka	A	G	10: 128,572,876 (GRCm39)		probably null	Het
Dlgap4	A	G	2: 156,588,111 (GRCm39)	I669V	probably benign	Het
Dsg1c	T	A	18: 20,412,298 (GRCm39)	D543E	probably benign	Het
Egflam	A	T	15: 7,271,906 (GRCm39)	C677*	probably null	Het
Eml5	A	C	12: 98,791,031 (GRCm39)		probably null	Het
Fbn1	G	A	2: 125,231,169 (GRCm39)	R466C	probably damaging	Het
Fnbp1	C	A	2: 30,948,990 (GRCm39)	D198Y	probably damaging	Het
Gfra3	T	A	18: 34,824,668 (GRCm39)	M272L	probably benign	Het
Gm5422	T	A	10: 31,126,156 (GRCm39)		noncoding transcript	Het
Gpr21	T	A	2: 37,407,556 (GRCm39)	I34N	probably damaging	Het
Hspb2	G	T	9: 50,662,664 (GRCm39)	T155K	probably benign	Het
Il21r	A	G	7: 125,224,457 (GRCm39)	T24A	probably benign	Het
Mmadhc	T	A	2: 50,182,847 (GRCm39)	H43L	possibly damaging	Het
Morn1	T	A	4: 155,195,473 (GRCm39)	D278E	possibly damaging	Het
Myoc	T	C	1: 162,476,243 (GRCm39)	Y316H	probably damaging	Het
Nags	A	G	11: 102,037,805 (GRCm39)	D266G	probably damaging	Het
Nlrp4b	A	G	7: 10,448,142 (GRCm39)	N115S	probably benign	Het
Nlrp5	T	A	7: 23,117,056 (GRCm39)	I260N	probably damaging	Het
Obscn	G	A	11: 58,926,905 (GRCm39)	R6190C	probably damaging	Het
Or5b24	T	C	19: 12,912,624 (GRCm39)	V174A	possibly damaging	Het
Or5be3	A	G	2: 86,863,812 (GRCm39)	F251S	probably damaging	Het
Orc4	C	T	2: 48,807,285 (GRCm39)	M215I	probably benign	Het
Osbpl6	A	T	2: 76,420,735 (GRCm39)	H770L	probably damaging	Het
Otogl	A	C	10: 107,616,849 (GRCm39)	N1809K	probably benign	Het
Pde3a	G	T	6: 141,437,957 (GRCm39)	V1009L	probably damaging	Het
Pign	T	C	1: 105,580,902 (GRCm39)	Y159C	probably damaging	Het
Pik3cg	C	A	12: 32,247,196 (GRCm39)	M842I	probably damaging	Het
Pnliprp1	C	T	19: 58,723,314 (GRCm39)	T235I	possibly damaging	Het
Pramel17	A	C	4: 101,692,611 (GRCm39)	V463G	probably damaging	Het
Prpf8	A	G	11: 75,381,480 (GRCm39)	N239D	probably damaging	Het
Psd2	T	A	18: 36,113,546 (GRCm39)		probably benign	Het
Ptprt	T	C	2: 161,393,668 (GRCm39)	D1251G	probably damaging	Het
Pwp2	G	A	10: 78,018,520 (GRCm39)	S88L	probably benign	Het
Rassf4	C	T	6: 116,624,516 (GRCm39)		probably benign	Het
Rexo1	A	G	10: 80,380,684 (GRCm39)	S884P	probably damaging	Het
Rgs20	C	A	1: 5,091,037 (GRCm39)	R131L	possibly damaging	Het
Setd4	A	G	16: 93,386,834 (GRCm39)	V288A	probably benign	Het
Stx3	G	T	19: 11,763,110 (GRCm39)	T160K	probably damaging	Het
Tas2r102	T	A	6: 132,739,636 (GRCm39)	S181R	probably damaging	Het
Tenm3	T	C	8: 49,127,434 (GRCm39)		probably benign	Het
Tmem33	T	C	5: 67,421,603 (GRCm39)		probably benign	Het
Trim33	A	G	3: 103,259,306 (GRCm39)		probably benign	Het
Trp53bp1	A	G	2: 121,058,653 (GRCm39)		probably benign	Het
Tuba4a	T	C	1: 75,193,017 (GRCm39)	D199G	probably benign	Het
Zcchc4	A	G	5: 52,953,321 (GRCm39)	Y110C	probably damaging	Het
Zp2	C	T	7: 119,734,693 (GRCm39)		probably benign	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101,852,406 (GRCm39)	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101,851,570 (GRCm39)	nonsense	probably null
IGL00972:Trip11	APN	12	101,860,596 (GRCm39)	missense	probably null	1.00
IGL01476:Trip11	APN	12	101,865,170 (GRCm39)	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101,849,604 (GRCm39)	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101,845,121 (GRCm39)	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101,850,890 (GRCm39)	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101,838,090 (GRCm39)	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101,850,747 (GRCm39)	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101,851,935 (GRCm39)	missense	probably benign
IGL01924:Trip11	APN	12	101,853,143 (GRCm39)	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101,850,572 (GRCm39)	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101,861,942 (GRCm39)	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101,859,780 (GRCm39)	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101,849,649 (GRCm39)	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101,850,260 (GRCm39)	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101,852,284 (GRCm39)	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101,853,097 (GRCm39)	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101,850,195 (GRCm39)	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101,865,184 (GRCm39)	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101,849,677 (GRCm39)	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101,851,278 (GRCm39)	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101,860,580 (GRCm39)	splice site	probably null
R0027:Trip11	UTSW	12	101,851,428 (GRCm39)	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101,851,016 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101,851,931 (GRCm39)	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101,850,777 (GRCm39)	nonsense	probably null
R0626:Trip11	UTSW	12	101,852,235 (GRCm39)	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101,852,419 (GRCm39)	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101,879,026 (GRCm39)	missense	unknown
R1647:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1648:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1856:Trip11	UTSW	12	101,849,592 (GRCm39)	nonsense	probably null
R2013:Trip11	UTSW	12	101,803,981 (GRCm39)	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101,851,619 (GRCm39)	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101,865,236 (GRCm39)	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101,845,086 (GRCm39)	makesense	probably null
R2513:Trip11	UTSW	12	101,803,986 (GRCm39)	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101,859,953 (GRCm39)	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101,860,581 (GRCm39)	nonsense	probably null
R4124:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4126:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4128:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4175:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4176:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4181:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101,852,127 (GRCm39)	nonsense	probably null
R4302:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101,853,198 (GRCm39)	missense	probably benign
R4342:Trip11	UTSW	12	101,850,575 (GRCm39)	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101,852,499 (GRCm39)	nonsense	probably null
R4586:Trip11	UTSW	12	101,849,600 (GRCm39)	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101,803,875 (GRCm39)	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101,851,549 (GRCm39)	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101,851,705 (GRCm39)	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101,853,065 (GRCm39)	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101,851,169 (GRCm39)	nonsense	probably null
R5017:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101,851,179 (GRCm39)	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101,851,860 (GRCm39)	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101,851,386 (GRCm39)	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5755:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5890:Trip11	UTSW	12	101,852,231 (GRCm39)	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101,849,738 (GRCm39)	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101,856,001 (GRCm39)	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101,865,154 (GRCm39)	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101,856,859 (GRCm39)	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101,851,837 (GRCm39)	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101,851,790 (GRCm39)	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101,803,886 (GRCm39)	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101,859,942 (GRCm39)	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101,852,126 (GRCm39)	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101,850,329 (GRCm39)	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101,850,611 (GRCm39)	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101,851,457 (GRCm39)	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101,850,278 (GRCm39)	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101,851,639 (GRCm39)	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101,851,694 (GRCm39)	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101,853,233 (GRCm39)	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101,811,114 (GRCm39)	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101,849,796 (GRCm39)	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101,844,403 (GRCm39)	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101,803,924 (GRCm39)	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101,849,741 (GRCm39)	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101,860,643 (GRCm39)	missense	possibly damaging	0.73
R8294:Trip11	UTSW	12	101,811,160 (GRCm39)	missense	possibly damaging	0.93
R8318:Trip11	UTSW	12	101,879,063 (GRCm39)	missense	unknown
R8690:Trip11	UTSW	12	101,839,656 (GRCm39)	missense	possibly damaging	0.76
R8879:Trip11	UTSW	12	101,828,857 (GRCm39)	missense	probably benign	0.00
R8964:Trip11	UTSW	12	101,811,315 (GRCm39)	critical splice donor site	probably null
R9005:Trip11	UTSW	12	101,845,131 (GRCm39)	missense	probably benign	0.02
R9013:Trip11	UTSW	12	101,851,377 (GRCm39)	missense	probably damaging	0.99
R9020:Trip11	UTSW	12	101,850,770 (GRCm39)	missense	possibly damaging	0.91
R9041:Trip11	UTSW	12	101,845,127 (GRCm39)	missense	probably benign	0.06
R9234:Trip11	UTSW	12	101,811,990 (GRCm39)	critical splice donor site	probably null
R9447:Trip11	UTSW	12	101,850,148 (GRCm39)	missense	probably damaging	1.00
R9631:Trip11	UTSW	12	101,859,807 (GRCm39)	missense	probably benign
R9641:Trip11	UTSW	12	101,859,957 (GRCm39)	nonsense	probably null
R9691:Trip11	UTSW	12	101,850,123 (GRCm39)	missense	probably benign	0.00
R9751:Trip11	UTSW	12	101,850,765 (GRCm39)	missense	possibly damaging	0.54
X0020:Trip11	UTSW	12	101,852,172 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGTGCTAACTTGTTCACATCCC -3'
(R):5'- GCAAAACTACATGACCGGAGGCTG -3'

Sequencing Primer
(F):5'- TCAGAGCTGAAGAGCTTCAAATC -3'
(R):5'- TGGCATGGTTCCAGTACAAAG -3'

Posted On

2013-06-11