Incidental Mutation 'R0573:Basp1'
ID46551
Institutional Source Beutler Lab
Gene Symbol Basp1
Ensembl Gene ENSMUSG00000045763
Gene Namebrain abundant, membrane attached signal protein 1
SynonymsCkap3, CAP-23, 2610024P12Rik, CAP23
MMRRC Submission 038763-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location25363277-25413764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25364862 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 16 (D16E)
Ref Sequence ENSEMBL: ENSMUSP00000154675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058845] [ENSMUST00000228597]
Predicted Effect unknown
Transcript: ENSMUST00000058845
AA Change: D16E
SMART Domains Protein: ENSMUSP00000053943
Gene: ENSMUSG00000045763
AA Change: D16E

DomainStartEndE-ValueType
Pfam:BASP1 2 226 5.2e-73 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000228597
AA Change: D16E
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, hyperactivity, decreased body weight, and defects in neurite axon outgrowth, Schwann cell morphology, and brain ventricle size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Adcy8 A T 15: 64,822,195 V411D probably damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Basp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Basp1 APN 15 25364867 missense unknown
R3796:Basp1 UTSW 15 25364312 unclassified probably benign
R3797:Basp1 UTSW 15 25364312 unclassified probably benign
R3798:Basp1 UTSW 15 25364312 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAGGTTTAGAGTCTGAAGCCGCCG -3'
(R):5'- TGGTAGAATGCCCGTGAAGTCCAG -3'

Sequencing Primer
(F):5'- GGGAGCCTCAGTCTTTTTGG -3'
(R):5'- GTGAAGTCCAGGCTGCTC -3'
Posted On2013-06-11