Incidental Mutation 'R0573:Adcy8'
ID46552
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
MMRRC Submission 038763-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0573 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64822195 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 411 (V411D)
Ref Sequence ENSEMBL: ENSMUSP00000154029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000180105] [ENSMUST00000228014]
Predicted Effect probably damaging
Transcript: ENSMUST00000023007
AA Change: V411D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: V411D

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180105
SMART Domains Protein: ENSMUSP00000136962
Gene: ENSMUSG00000094296

DomainStartEndE-ValueType
low complexity region 60 87 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228014
AA Change: V411D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228109
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b A T 12: 113,491,658 K698N possibly damaging Het
Arfgef3 T A 10: 18,599,288 E1550V probably damaging Het
Asb3 T A 11: 31,061,406 I306K probably damaging Het
Asic4 T A 1: 75,469,102 probably benign Het
B020004J07Rik A C 4: 101,835,414 V463G probably damaging Het
Basp1 G T 15: 25,364,862 D16E unknown Het
Cbll1 A T 12: 31,490,540 I123N probably damaging Het
Ccdc141 A T 2: 77,039,493 H889Q probably benign Het
Ccdc65 T C 15: 98,721,049 V303A probably benign Het
Ceacam20 T A 7: 19,986,668 M60K probably damaging Het
Chd9 T A 8: 90,998,595 V711D probably damaging Het
Clcn1 T A 6: 42,313,045 probably null Het
Col16a1 A T 4: 130,068,475 probably benign Het
Col4a3 C A 1: 82,716,363 P1568Q possibly damaging Het
Colec12 C A 18: 9,858,650 P478T probably damaging Het
Dchs1 T C 7: 105,758,778 H1949R probably damaging Het
Dgka A G 10: 128,737,007 probably null Het
Dlgap4 A G 2: 156,746,191 I669V probably benign Het
Dsg1c T A 18: 20,279,241 D543E probably benign Het
Egflam A T 15: 7,242,425 C677* probably null Het
Eml5 A C 12: 98,824,772 probably null Het
Fbn1 G A 2: 125,389,249 R466C probably damaging Het
Fnbp1 C A 2: 31,058,978 D198Y probably damaging Het
Gfra3 T A 18: 34,691,615 M272L probably benign Het
Gm5422 T A 10: 31,250,160 noncoding transcript Het
Gpr21 T A 2: 37,517,544 I34N probably damaging Het
Hspb2 G T 9: 50,751,364 T155K probably benign Het
Il21r A G 7: 125,625,285 T24A probably benign Het
Mmadhc T A 2: 50,292,835 H43L possibly damaging Het
Morn1 T A 4: 155,111,016 D278E possibly damaging Het
Myoc T C 1: 162,648,674 Y316H probably damaging Het
Nags A G 11: 102,146,979 D266G probably damaging Het
Nlrp4b A G 7: 10,714,215 N115S probably benign Het
Nlrp5 T A 7: 23,417,631 I260N probably damaging Het
Obscn G A 11: 59,036,079 R6190C probably damaging Het
Olfr1105 A G 2: 87,033,468 F251S probably damaging Het
Olfr1449 T C 19: 12,935,260 V174A possibly damaging Het
Orc4 C T 2: 48,917,273 M215I probably benign Het
Osbpl6 A T 2: 76,590,391 H770L probably damaging Het
Otogl A C 10: 107,780,988 N1809K probably benign Het
Pde3a G T 6: 141,492,231 V1009L probably damaging Het
Pign T C 1: 105,653,177 Y159C probably damaging Het
Pik3cg C A 12: 32,197,197 M842I probably damaging Het
Pnliprp1 C T 19: 58,734,882 T235I possibly damaging Het
Prpf8 A G 11: 75,490,654 N239D probably damaging Het
Psd2 T A 18: 35,980,493 probably benign Het
Ptprt T C 2: 161,551,748 D1251G probably damaging Het
Pwp2 G A 10: 78,182,686 S88L probably benign Het
Rassf4 C T 6: 116,647,555 probably benign Het
Rexo1 A G 10: 80,544,850 S884P probably damaging Het
Rgs20 C A 1: 5,020,814 R131L possibly damaging Het
Setd4 A G 16: 93,589,946 V288A probably benign Het
Stx3 G T 19: 11,785,746 T160K probably damaging Het
Tas2r102 T A 6: 132,762,673 S181R probably damaging Het
Tenm3 T C 8: 48,674,399 probably benign Het
Tmem33 T C 5: 67,264,260 probably benign Het
Trim33 A G 3: 103,351,990 probably benign Het
Trip11 A G 12: 101,886,860 I491T probably benign Het
Trp53bp1 A G 2: 121,228,172 probably benign Het
Tuba4a T C 1: 75,216,373 D199G probably benign Het
Zcchc4 A G 5: 52,795,979 Y110C probably damaging Het
Zp2 C T 7: 120,135,470 probably benign Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GATGCCTCCAGGTGGGATTTTCAG -3'
(R):5'- TGTCTCCAAGTTCAGCCTAACAAGC -3'

Sequencing Primer
(F):5'- AGCATTCTTCTCCAGTCTCAAAC -3'
(R):5'- GTTCAGCCTAACAAGCTGTCC -3'
Posted On2013-06-11