Incidental Mutation 'R0440:Ass1'
ID46671
Institutional Source Beutler Lab
Gene Symbol Ass1
Ensembl Gene ENSMUSG00000076441
Gene Nameargininosuccinate synthetase 1
SynonymsAss-1, ASS, fold
MMRRC Submission 038641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0440 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location31470207-31520672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31514819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 371 (N371Y)
Ref Sequence ENSEMBL: ENSMUSP00000099904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102840]
Predicted Effect probably damaging
Transcript: ENSMUST00000102840
AA Change: N371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: N371Y

DomainStartEndE-ValueType
Pfam:QueC 6 93 2.8e-7 PFAM
Pfam:Arginosuc_synth 8 403 1.9e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192802
Meta Mutation Damage Score 0.722 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt G A 15: 83,228,493 R30W probably damaging Het
Adam7 T C 14: 68,510,856 probably null Het
Agl A T 3: 116,758,806 L1158Q probably damaging Het
Akap9 T C 5: 4,064,569 S66P probably damaging Het
Akr1c20 T A 13: 4,487,208 D316V probably benign Het
App C A 16: 85,056,414 E259* probably null Het
Arhgef4 A G 1: 34,745,448 probably null Het
Armc9 G A 1: 86,194,262 probably null Het
Btaf1 C T 19: 36,986,653 P875S probably damaging Het
Cc2d1b T A 4: 108,625,816 probably null Het
Ccar1 C T 10: 62,780,457 V165I possibly damaging Het
Ccdc106 A T 7: 5,060,245 I250F probably damaging Het
Ccny T C 18: 9,332,917 I205V probably benign Het
Cfap52 T A 11: 67,954,088 I52L probably benign Het
Chd8 T A 14: 52,204,826 T2096S possibly damaging Het
Clstn3 G A 6: 124,451,413 T423I probably damaging Het
Col13a1 T C 10: 61,867,483 D440G possibly damaging Het
Dclk3 G A 9: 111,469,163 V592M probably damaging Het
Ddx31 A T 2: 28,857,132 I208F probably damaging Het
Dlat A T 9: 50,645,119 probably null Het
Eml4 T C 17: 83,446,058 probably null Het
Enpp2 T A 15: 54,847,237 probably benign Het
Fryl T C 5: 73,086,972 S38G possibly damaging Het
Gcnt1 G A 19: 17,330,316 T15I probably benign Het
Gm21834 T C 17: 57,742,126 T32A possibly damaging Het
Golga2 A G 2: 32,302,933 D394G probably damaging Het
Gtf3c4 G T 2: 28,840,169 probably null Het
Igkv4-69 A G 6: 69,284,269 probably benign Het
Inpp5j T C 11: 3,501,150 R500G possibly damaging Het
Kif5b A T 18: 6,226,980 probably benign Het
Klhl36 A G 8: 119,876,551 E515G probably damaging Het
Lifr C T 15: 7,157,191 R59* probably null Het
Lrif1 A T 3: 106,734,398 Q10L possibly damaging Het
Lrp8 A G 4: 107,869,098 E908G probably damaging Het
Lrrc23 A T 6: 124,770,704 D307E probably benign Het
Mpv17l T C 16: 13,944,719 F27L probably damaging Het
Mta3 C T 17: 83,766,587 A76V probably damaging Het
Muc5ac T A 7: 141,792,034 Y202* probably null Het
Naprt A G 15: 75,891,069 probably benign Het
Npr2 T A 4: 43,650,315 V960D probably damaging Het
Oca2 A T 7: 56,423,352 Y765F probably benign Het
Olfr715 A T 7: 107,128,732 H220Q probably benign Het
Plxna2 T A 1: 194,644,404 Y215* probably null Het
Prdm16 G A 4: 154,476,627 probably benign Het
Ptn A G 6: 36,744,497 S3P probably benign Het
Pus10 T C 11: 23,673,331 probably benign Het
Rad21 A T 15: 51,968,358 D442E probably benign Het
Rmdn2 A G 17: 79,667,955 H291R probably damaging Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Samd4b A T 7: 28,408,160 I228N probably benign Het
Sdr9c7 G T 10: 127,898,953 probably benign Het
Slc13a2 T C 11: 78,403,175 N254D probably benign Het
Slc16a8 T A 15: 79,252,607 I132F probably damaging Het
Slc18b1 T A 10: 23,819,078 Y274N probably benign Het
Slc45a2 A T 15: 11,000,817 M1L probably benign Het
Smc1b A G 15: 85,112,673 probably benign Het
Stab2 T C 10: 86,949,928 S617G probably benign Het
Stk10 A G 11: 32,604,190 M626V probably damaging Het
Synpo2l T G 14: 20,661,398 I385L possibly damaging Het
Tmprss11d T C 5: 86,338,812 Y73C probably damaging Het
Ttc21b A G 2: 66,236,382 V309A probably benign Het
Tubgcp6 A G 15: 89,103,065 I1235T probably benign Het
Usp8 A G 2: 126,725,390 I110V probably benign Het
Vps13c G A 9: 67,972,861 G3442S probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp207 T A 11: 80,395,507 probably benign Het
Zfp748 A C 13: 67,553,025 probably null Het
Other mutations in Ass1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ass1 APN 2 31476922 missense probably damaging 1.00
IGL02152:Ass1 APN 2 31492324 missense probably damaging 1.00
R0008:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0083:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0084:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0085:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0087:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0183:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0220:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0254:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0302:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0346:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0472:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0605:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0644:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R1460:Ass1 UTSW 2 31514741 missense probably benign 0.37
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1770:Ass1 UTSW 2 31486516 missense probably benign 0.29
R1908:Ass1 UTSW 2 31493148 nonsense probably null
R2361:Ass1 UTSW 2 31520382 missense probably benign 0.02
R2430:Ass1 UTSW 2 31501496 missense probably damaging 1.00
R3816:Ass1 UTSW 2 31510105 splice site probably benign
R4614:Ass1 UTSW 2 31514783 missense probably damaging 1.00
R4628:Ass1 UTSW 2 31480988 missense probably damaging 1.00
R5007:Ass1 UTSW 2 31501532 missense possibly damaging 0.90
R5069:Ass1 UTSW 2 31510173 missense probably damaging 1.00
R5081:Ass1 UTSW 2 31488653 critical splice donor site probably null
R5315:Ass1 UTSW 2 31492329 missense probably benign 0.21
R5370:Ass1 UTSW 2 31518733 missense possibly damaging 0.56
R6259:Ass1 UTSW 2 31488642 missense possibly damaging 0.80
R6541:Ass1 UTSW 2 31510233 missense probably damaging 0.99
R6731:Ass1 UTSW 2 31514784 missense probably damaging 1.00
R6927:Ass1 UTSW 2 31514801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAAGGCAGAACCGAGCCTATCAG -3'
(R):5'- TGCGCCACAGCCTAACTTTTATACC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'
Posted On2013-06-11