Incidental Mutation 'R0471:P4ha2'
ID46772
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
SynonymsP4hl
MMRRC Submission 038671-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R0471 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54100095-54131665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54117608 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 214 (Y214H)
Ref Sequence ENSEMBL: ENSMUSP00000133275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000138477] [ENSMUST00000141258] [ENSMUST00000151218] [ENSMUST00000174616]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019050
AA Change: Y214H

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906
AA Change: Y214H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000093107
AA Change: Y214H

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906
AA Change: Y214H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125651
Predicted Effect probably benign
Transcript: ENSMUST00000138477
SMART Domains Protein: ENSMUSP00000121119
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 158 3.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141258
Predicted Effect probably benign
Transcript: ENSMUST00000151218
SMART Domains Protein: ENSMUSP00000118384
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 128 6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155299
Predicted Effect possibly damaging
Transcript: ENSMUST00000174616
AA Change: Y214H

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906
AA Change: Y214H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik G A 4: 35,193,257 T232I probably benign Het
Acp6 T C 3: 97,168,575 probably null Het
Adam33 C A 2: 131,054,479 G437C probably damaging Het
Aldh1a1 T A 19: 20,602,013 M1K probably null Het
Amotl2 C A 9: 102,720,519 P126Q probably damaging Het
Ap1g1 T A 8: 109,853,643 M576K possibly damaging Het
Apob C A 12: 7,990,406 A581E probably damaging Het
Asb7 A T 7: 66,679,159 D44E probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Ccdc65 A T 15: 98,717,467 H118L probably benign Het
Cdc25b A G 2: 131,197,284 E523G probably damaging Het
Cdk11b A G 4: 155,647,542 probably benign Het
Clec1b A G 6: 129,401,607 probably benign Het
Cntrl A G 2: 35,127,380 T400A probably benign Het
Cpne4 T G 9: 105,022,282 probably null Het
Cyp2j6 T A 4: 96,531,748 R249* probably null Het
Dock2 T C 11: 34,688,553 I678V probably benign Het
Dqx1 C T 6: 83,059,426 probably benign Het
Dsp A T 13: 38,193,350 K1704* probably null Het
Eif2b2 T C 12: 85,220,183 F121S probably benign Het
Ephx4 T C 5: 107,413,513 V69A possibly damaging Het
Epn2 T C 11: 61,535,308 Q281R probably damaging Het
Fgf3 A C 7: 144,842,810 D187A probably damaging Het
Galnt18 C A 7: 111,779,299 probably benign Het
Gm4871 C T 5: 145,031,592 probably benign Het
Ick G T 9: 78,155,517 probably null Het
Inpp4b T C 8: 82,041,899 I679T possibly damaging Het
Itpkb A G 1: 180,418,255 E779G probably damaging Het
Itsn1 G A 16: 91,899,589 V27M probably damaging Het
Lrp2 C A 2: 69,525,234 R422L probably damaging Het
Mmp25 G A 17: 23,639,884 A231V possibly damaging Het
Mprip T C 11: 59,759,735 S1422P probably damaging Het
Mro A T 18: 73,876,789 Q176L probably benign Het
Mrpl12 A G 11: 120,488,403 E192G probably damaging Het
Myo5b A T 18: 74,728,954 probably benign Het
Ncam2 G T 16: 81,200,884 probably benign Het
Nip7 T C 8: 107,057,317 L63P probably damaging Het
Nsd3 T C 8: 25,648,434 probably benign Het
Nup98 A T 7: 102,138,797 V1022D probably benign Het
Olfr1173 A G 2: 88,274,215 V278A possibly damaging Het
Olfr1391 T A 11: 49,327,917 C169S probably damaging Het
Olfr190 A G 16: 59,074,270 I270T probably benign Het
Olfr846 A T 9: 19,360,881 L158* probably null Het
Pacrg A T 17: 10,576,478 F184L possibly damaging Het
Parpbp T A 10: 88,093,707 R426S probably damaging Het
Pcdhb5 T A 18: 37,321,306 Y246* probably null Het
Pik3cg T A 12: 32,194,771 T895S probably damaging Het
Prkch T C 12: 73,691,652 Y178H probably benign Het
Rusc2 G T 4: 43,425,486 R1197L probably damaging Het
Svep1 T C 4: 58,054,700 E3296G possibly damaging Het
Svs3a A G 2: 164,289,881 K123R probably benign Het
Sycp2l A G 13: 41,150,530 probably null Het
Syne3 T C 12: 104,943,426 H717R probably benign Het
Tiprl A G 1: 165,222,523 probably null Het
Trim24 T G 6: 37,915,195 V151G possibly damaging Het
Trim33 T C 3: 103,326,901 V56A possibly damaging Het
Trim67 C A 8: 124,794,658 T253K probably benign Het
Trip12 T C 1: 84,726,207 E698G probably damaging Het
Tspan14 T C 14: 40,915,396 D145G probably damaging Het
Ushbp1 G A 8: 71,394,377 Q204* probably null Het
Vmn1r71 G C 7: 10,748,092 S223C possibly damaging Het
Vmn2r75 G T 7: 86,165,513 N257K probably benign Het
Washc4 T C 10: 83,558,734 probably benign Het
Zc3h7b G A 15: 81,781,968 D560N probably damaging Het
Zscan21 T C 5: 138,125,140 V27A probably benign Het
Zzef1 A C 11: 72,923,111 E2842A probably damaging Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54119305 missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54120158 missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54114170 missense probably benign 0.07
IGL02053:P4ha2 APN 11 54117587 missense probably benign
FR4342:P4ha2 UTSW 11 54110251 small deletion probably benign
R0938:P4ha2 UTSW 11 54119322 missense possibly damaging 0.67
R1467:P4ha2 UTSW 11 54106410 intron probably benign
R1517:P4ha2 UTSW 11 54117645 missense probably benign
R1556:P4ha2 UTSW 11 54125010 missense probably damaging 0.98
R3498:P4ha2 UTSW 11 54119253 missense probably benign 0.28
R3916:P4ha2 UTSW 11 54126248 missense probably benign 0.07
R4853:P4ha2 UTSW 11 54120170 missense probably benign 0.01
R4932:P4ha2 UTSW 11 54125020 missense probably benign 0.05
R5020:P4ha2 UTSW 11 54131190 missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54120188 missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54126412 critical splice donor site probably null
R6632:P4ha2 UTSW 11 54117648 missense probably benign 0.07
R7023:P4ha2 UTSW 11 54131246 missense probably benign 0.01
R7068:P4ha2 UTSW 11 54110994 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAAAGTACCAGGCCATGCTGAG -3'
(R):5'- GCACATGAGCTACACACATGAATGC -3'

Sequencing Primer
(F):5'- CATGCTGAGTGTGGACGAC -3'
(R):5'- AGACAATCGTCACATTGTAACG -3'
Posted On2013-06-11