Incidental Mutation 'R0511:Csmd1'
ID46914
Institutional Source Beutler Lab
Gene Symbol Csmd1
Ensembl Gene ENSMUSG00000060924
Gene NameCUB and Sushi multiple domains 1
Synonyms
MMRRC Submission 038705-MU
Accession Numbers

Genbank: NM_053171.2

Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0511 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15892537-17535586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15932529 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 2713 (V2713M)
Ref Sequence ENSEMBL: ENSMUSP00000080751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082104
AA Change: V2713M

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: V2713M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
CUB 32 140 1.46e-26 SMART
CCP 145 202 1.01e-11 SMART
CUB 208 312 1.05e-27 SMART
CCP 349 406 1.28e-8 SMART
CUB 411 522 2.34e-25 SMART
CCP 527 580 1.22e-14 SMART
CUB 584 692 1.61e-37 SMART
CCP 697 754 4.41e-12 SMART
CUB 758 866 6.55e-38 SMART
CCP 873 926 2.53e-12 SMART
CUB 930 1040 8.94e-22 SMART
CCP 1045 1100 7.06e-11 SMART
CUB 1104 1212 3.14e-26 SMART
CCP 1217 1273 1.18e-12 SMART
CUB 1277 1386 9.72e-32 SMART
CCP 1391 1447 2.06e-12 SMART
CUB 1451 1559 1.68e-35 SMART
CCP 1564 1621 2.53e-12 SMART
CUB 1625 1733 4.24e-14 SMART
CCP 1741 1798 9.46e-12 SMART
CUB 1802 1910 4.23e-32 SMART
CCP 1915 1970 8.23e-12 SMART
CUB 1974 2082 8.59e-33 SMART
CCP 2087 2142 6.09e-15 SMART
CUB 2146 2253 2.36e-30 SMART
CCP 2258 2315 1.1e-12 SMART
CUB 2320 2430 4.3e-24 SMART
CCP 2432 2490 2.94e-8 SMART
CCP 2495 2552 2.03e-11 SMART
CCP 2557 2617 1.22e-5 SMART
CCP 2622 2675 2.72e-12 SMART
CCP 2680 2733 5.86e-17 SMART
CCP 2738 2791 6.09e-15 SMART
CCP 2796 2854 9.1e-14 SMART
CCP 2859 2912 3.96e-14 SMART
CCP 2920 2973 4.41e-12 SMART
CCP 2978 3032 2.94e-8 SMART
CCP 3037 3092 6.59e-11 SMART
CCP 3097 3150 4.12e-12 SMART
CCP 3155 3208 7.92e-14 SMART
CCP 3216 3270 2.8e-14 SMART
CCP 3275 3330 3.78e-11 SMART
transmembrane domain 3487 3509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125551
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (116/116)
MGI Phenotype PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,254,071 probably null Het
A630095E13Rik A T 9: 36,638,577 probably null Het
Abca13 G T 11: 9,294,559 V2141L probably benign Het
Adam17 T C 12: 21,340,458 probably benign Het
Adam3 A T 8: 24,695,315 C456S probably damaging Het
AI464131 A G 4: 41,498,538 F364S probably damaging Het
Aldh4a1 G T 4: 139,642,571 probably benign Het
Anapc4 A G 5: 52,842,017 probably benign Het
Ank3 A T 10: 69,882,368 Q483L probably damaging Het
Ankle2 A G 5: 110,242,059 probably benign Het
Ankrd13b T A 11: 77,473,288 T150S possibly damaging Het
Apeh A G 9: 108,087,055 M524T probably benign Het
Arl14epl T A 18: 46,926,417 probably null Het
Atg2a T C 19: 6,252,539 F964S possibly damaging Het
Atg2b C T 12: 105,617,153 V2050M probably damaging Het
Atp2b4 A T 1: 133,732,218 probably benign Het
Bbof1 T A 12: 84,430,271 S512T probably benign Het
BC055324 T C 1: 163,971,843 probably null Het
C130079G13Rik A G 3: 59,936,350 H155R possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Car10 T C 11: 93,490,582 Y100H probably damaging Het
Ccdc81 T A 7: 89,893,296 E124V probably damaging Het
Cd84 A G 1: 171,872,927 T204A probably benign Het
Celf2 A G 2: 6,604,176 S178P probably damaging Het
Chat G A 14: 32,409,019 T555M probably damaging Het
Chd6 A G 2: 160,992,191 F917S probably damaging Het
Chrna2 C A 14: 66,149,104 T233N probably damaging Het
Cnpy2 T C 10: 128,326,185 V109A probably benign Het
Col4a1 T C 8: 11,208,333 probably null Het
Cuedc1 G A 11: 88,183,405 R255Q probably damaging Het
Cxcl15 A T 5: 90,798,038 probably benign Het
Dach1 A T 14: 97,901,329 H559Q possibly damaging Het
Dennd4c C T 4: 86,826,022 T1367M probably damaging Het
Depdc5 T A 5: 32,945,028 Y365* probably null Het
Dicer1 T C 12: 104,702,841 Y1194C possibly damaging Het
Dmxl1 C G 18: 49,891,467 S1736* probably null Het
Dnah7a C T 1: 53,497,126 R2586K probably benign Het
Dnajb8 T C 6: 88,222,485 M1T probably null Het
Dync2h1 G A 9: 7,122,692 P2088L probably benign Het
Eftud2 T G 11: 102,844,222 H617P probably damaging Het
Ephb1 A G 9: 101,995,980 probably benign Het
Fam184a G T 10: 53,698,879 H155Q probably benign Het
Ganc G T 2: 120,448,401 E700* probably null Het
Gm10912 A G 2: 104,066,945 probably benign Het
Gm9047 G T 6: 29,478,170 probably benign Het
Haus5 A T 7: 30,659,067 I294N probably damaging Het
Hmgcr G T 13: 96,660,143 probably null Het
Hr T A 14: 70,561,912 C641* probably null Het
Itga10 A G 3: 96,658,174 N1038S probably damaging Het
Itgb1bp1 T G 12: 21,271,435 Y172S probably damaging Het
Kprp T C 3: 92,824,723 N340S probably damaging Het
Kremen1 A G 11: 5,215,447 I41T probably damaging Het
Krt6b A G 15: 101,677,607 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Ldhd A G 8: 111,629,677 Y86H probably benign Het
Lilra6 A T 7: 3,912,785 I76N possibly damaging Het
Mak T C 13: 41,046,267 T299A probably benign Het
Med25 A G 7: 44,885,078 probably null Het
Mpg A T 11: 32,230,039 N189I probably damaging Het
Mroh8 A G 2: 157,229,918 Y556H probably damaging Het
Myh8 T A 11: 67,284,507 S294T probably benign Het
Myom1 T A 17: 71,084,317 D842E probably benign Het
Nat2 C T 8: 67,501,330 Q31* probably null Het
Nf1 T A 11: 79,438,769 M653K probably benign Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Npr2 A G 4: 43,632,801 E206G probably benign Het
Nsd3 G A 8: 25,678,716 G629D possibly damaging Het
Nwd1 G A 8: 72,682,005 C831Y probably damaging Het
Olfr1094 A G 2: 86,829,606 I285V probably benign Het
Olfr584 T C 7: 103,085,851 I111T probably damaging Het
P2ry14 A G 3: 59,116,028 S4P possibly damaging Het
Parp4 A G 14: 56,635,715 probably benign Het
Pclo A G 5: 14,678,285 probably benign Het
Pclo T C 5: 14,679,398 probably benign Het
Pcnt A T 10: 76,404,595 S1202T possibly damaging Het
Pfkfb4 A G 9: 109,027,757 Y412C probably damaging Het
Pgm1 T A 5: 64,110,555 V449D probably damaging Het
Poldip3 T A 15: 83,138,235 D116V probably damaging Het
Pom121 G T 5: 135,381,832 Q824K unknown Het
Prkdc G T 16: 15,831,282 G3707* probably null Het
Prr14l T C 5: 32,844,216 probably benign Het
Ptbp2 T G 3: 119,720,964 I405L probably benign Het
Rad21l A T 2: 151,649,069 probably benign Het
Rbm6 G A 9: 107,847,289 Q488* probably null Het
Rdh1 T A 10: 127,764,783 M225K probably benign Het
Recql5 T C 11: 115,928,383 D119G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 T C 16: 73,013,125 probably null Het
Samd12 G A 15: 53,860,171 T42I probably benign Het
Scn10a A T 9: 119,613,700 M1494K probably damaging Het
Sec31a G A 5: 100,375,240 P864L probably benign Het
Senp2 T C 16: 22,036,570 V344A probably benign Het
Serpina5 G A 12: 104,103,362 D278N probably benign Het
Sh3tc1 A T 5: 35,703,462 V1017D probably damaging Het
Sin3a T A 9: 57,096,895 Y310* probably null Het
Slc25a32 T C 15: 39,097,545 T248A probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc4a10 G A 2: 62,286,862 V722M probably damaging Het
Slco1a4 A G 6: 141,830,860 probably benign Het
Smg6 T A 11: 74,929,058 Y52N probably damaging Het
Sncb T G 13: 54,765,587 T33P probably damaging Het
Spef2 A G 15: 9,583,984 probably null Het
Sugp1 A G 8: 70,059,363 E203G probably damaging Het
Suv39h2 A T 2: 3,472,579 C105S probably damaging Het
Tlr1 A T 5: 64,926,620 F205I probably damaging Het
Tnip1 A T 11: 54,917,873 M496K probably damaging Het
Tnxb G A 17: 34,718,245 E2889K probably damaging Het
Trim30b T A 7: 104,365,803 H126L possibly damaging Het
Trpm7 A T 2: 126,826,718 Y759* probably null Het
Ttc17 A G 2: 94,323,120 I1000T possibly damaging Het
Ttc27 A T 17: 74,718,715 N61I probably benign Het
Uba6 T C 5: 86,112,750 Y990C probably damaging Het
Vav3 A G 3: 109,664,440 probably benign Het
Vmn2r55 C T 7: 12,671,018 A153T possibly damaging Het
Wars2 A G 3: 99,216,549 D242G probably damaging Het
Xylt2 G A 11: 94,669,936 Q259* probably null Het
Zfp27 G A 7: 29,894,522 P673S probably damaging Het
Zgrf1 T C 3: 127,584,660 I1023T possibly damaging Het
Other mutations in Csmd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Csmd1 APN 8 16009297 splice site probably benign
IGL00433:Csmd1 APN 8 16231373 missense probably damaging 1.00
IGL00500:Csmd1 APN 8 15921139 missense probably damaging 1.00
IGL00666:Csmd1 APN 8 16189990 missense probably damaging 1.00
IGL00913:Csmd1 APN 8 16071287 missense probably benign 0.00
IGL01012:Csmd1 APN 8 15917341 missense probably benign 0.00
IGL01123:Csmd1 APN 8 17534928 missense possibly damaging 0.96
IGL01348:Csmd1 APN 8 15910596 missense probably damaging 0.99
IGL01444:Csmd1 APN 8 16200055 missense probably benign 0.00
IGL01530:Csmd1 APN 8 15903195 missense probably damaging 0.99
IGL01548:Csmd1 APN 8 16288646 nonsense probably null
IGL01814:Csmd1 APN 8 16501375 missense probably damaging 1.00
IGL01889:Csmd1 APN 8 15998857 missense probably damaging 1.00
IGL02055:Csmd1 APN 8 16069001 missense probably damaging 0.99
IGL02066:Csmd1 APN 8 15926594 missense probably damaging 1.00
IGL02097:Csmd1 APN 8 16211759 missense probably null 0.17
IGL02112:Csmd1 APN 8 16081705 missense probably benign 0.18
IGL02161:Csmd1 APN 8 16358412 missense probably damaging 0.97
IGL02189:Csmd1 APN 8 16271606 missense probably damaging 0.99
IGL02272:Csmd1 APN 8 16199893 missense probably damaging 0.99
IGL02292:Csmd1 APN 8 16211870 missense probably damaging 1.00
IGL02385:Csmd1 APN 8 15903275 missense probably benign 0.08
IGL02424:Csmd1 APN 8 16092326 missense probably benign 0.22
IGL02492:Csmd1 APN 8 16002597 missense probably benign 0.13
IGL02507:Csmd1 APN 8 17534976 utr 5 prime probably benign
IGL02513:Csmd1 APN 8 15999869 splice site probably benign
IGL02727:Csmd1 APN 8 16231327 missense probably damaging 1.00
IGL02728:Csmd1 APN 8 15999779 critical splice donor site probably null
IGL02852:Csmd1 APN 8 15895728 missense probably damaging 0.99
IGL02935:Csmd1 APN 8 16223334 missense probably damaging 1.00
IGL02945:Csmd1 APN 8 16271570 missense possibly damaging 0.92
IGL02959:Csmd1 APN 8 15910465 missense probably damaging 0.99
IGL03113:Csmd1 APN 8 16028698 missense probably benign
IGL03129:Csmd1 APN 8 15961521 missense probably damaging 0.99
IGL03131:Csmd1 APN 8 16088217 missense probably damaging 1.00
IGL03275:Csmd1 APN 8 16157092 missense probably benign 0.00
IGL03297:Csmd1 APN 8 16009432 nonsense probably null
I2289:Csmd1 UTSW 8 15912381 missense probably benign 0.10
IGL03055:Csmd1 UTSW 8 16095501 missense probably damaging 1.00
IGL03097:Csmd1 UTSW 8 15945127 missense probably damaging 1.00
R0037:Csmd1 UTSW 8 15917248 missense probably damaging 0.97
R0095:Csmd1 UTSW 8 16233051 missense probably damaging 1.00
R0113:Csmd1 UTSW 8 15984849 missense probably damaging 1.00
R0129:Csmd1 UTSW 8 16079942 missense possibly damaging 0.95
R0144:Csmd1 UTSW 8 16391824 missense probably benign 0.16
R0166:Csmd1 UTSW 8 16233022 missense probably benign 0.29
R0227:Csmd1 UTSW 8 16391822 missense probably benign 0.05
R0279:Csmd1 UTSW 8 16223235 missense probably damaging 0.99
R0280:Csmd1 UTSW 8 16271602 missense probably damaging 1.00
R0312:Csmd1 UTSW 8 15984760 missense probably damaging 1.00
R0355:Csmd1 UTSW 8 15918330 missense probably damaging 0.97
R0367:Csmd1 UTSW 8 15917270 missense probably damaging 1.00
R0395:Csmd1 UTSW 8 16346638 missense probably damaging 0.99
R0413:Csmd1 UTSW 8 16710514 missense probably damaging 0.97
R0457:Csmd1 UTSW 8 16501393 critical splice acceptor site probably null
R0463:Csmd1 UTSW 8 15921759 missense probably damaging 0.99
R0482:Csmd1 UTSW 8 16233101 missense probably damaging 1.00
R0501:Csmd1 UTSW 8 17027323 missense probably damaging 0.97
R0505:Csmd1 UTSW 8 15992758 missense probably damaging 1.00
R0507:Csmd1 UTSW 8 16185344 splice site probably benign
R0555:Csmd1 UTSW 8 16185273 missense probably benign
R0580:Csmd1 UTSW 8 15910528 missense probably damaging 1.00
R0610:Csmd1 UTSW 8 15918208 missense possibly damaging 0.95
R0634:Csmd1 UTSW 8 16226391 missense probably damaging 1.00
R0666:Csmd1 UTSW 8 16069049 missense possibly damaging 0.88
R0674:Csmd1 UTSW 8 16000550 missense probably benign 0.03
R0675:Csmd1 UTSW 8 16158131 missense probably benign 0.01
R0763:Csmd1 UTSW 8 17027284 missense possibly damaging 0.67
R0781:Csmd1 UTSW 8 15921174 missense probably benign 0.35
R0862:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0864:Csmd1 UTSW 8 16190026 missense probably damaging 0.99
R0925:Csmd1 UTSW 8 16710618 missense probably benign 0.29
R0926:Csmd1 UTSW 8 16033576 splice site probably null
R1005:Csmd1 UTSW 8 16288693 missense probably damaging 0.99
R1073:Csmd1 UTSW 8 16358463 splice site probably benign
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1185:Csmd1 UTSW 8 16358348 missense probably damaging 0.96
R1256:Csmd1 UTSW 8 16079964 missense probably damaging 1.00
R1294:Csmd1 UTSW 8 16698036 missense probably damaging 0.99
R1375:Csmd1 UTSW 8 16463081 splice site probably null
R1447:Csmd1 UTSW 8 15925306 nonsense probably null
R1450:Csmd1 UTSW 8 15945180 critical splice acceptor site probably null
R1470:Csmd1 UTSW 8 16157204 splice site probably benign
R1580:Csmd1 UTSW 8 15925299 missense probably damaging 1.00
R1591:Csmd1 UTSW 8 15900710 missense probably damaging 0.99
R1658:Csmd1 UTSW 8 16081725 missense possibly damaging 0.69
R1678:Csmd1 UTSW 8 15918252 missense possibly damaging 0.58
R1717:Csmd1 UTSW 8 17216692 missense possibly damaging 0.58
R1735:Csmd1 UTSW 8 15932610 missense probably damaging 0.99
R1750:Csmd1 UTSW 8 15917303 missense probably damaging 0.99
R1753:Csmd1 UTSW 8 16157120 nonsense probably null
R1822:Csmd1 UTSW 8 16223326 missense probably damaging 1.00
R1875:Csmd1 UTSW 8 15929101 missense probably damaging 0.99
R1909:Csmd1 UTSW 8 15906116 missense probably damaging 1.00
R1912:Csmd1 UTSW 8 16233998 critical splice donor site probably null
R1993:Csmd1 UTSW 8 16346684 missense probably damaging 0.99
R2067:Csmd1 UTSW 8 15900782 missense probably benign
R2094:Csmd1 UTSW 8 16079978 missense probably damaging 0.99
R2119:Csmd1 UTSW 8 17216733 missense probably damaging 0.98
R2127:Csmd1 UTSW 8 15917392 missense probably damaging 1.00
R2138:Csmd1 UTSW 8 15929088 missense probably damaging 0.96
R2216:Csmd1 UTSW 8 17027339 critical splice acceptor site probably null
R2220:Csmd1 UTSW 8 15992641 missense possibly damaging 0.94
R2380:Csmd1 UTSW 8 16190087 missense probably damaging 1.00
R2471:Csmd1 UTSW 8 16211762 missense probably damaging 1.00
R2984:Csmd1 UTSW 8 15953782 missense probably damaging 1.00
R3001:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3002:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3003:Csmd1 UTSW 8 16196170 missense probably damaging 0.98
R3103:Csmd1 UTSW 8 15917405 missense probably damaging 1.00
R3104:Csmd1 UTSW 8 17027231 missense probably damaging 1.00
R3620:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3621:Csmd1 UTSW 8 15992684 missense probably benign 0.29
R3748:Csmd1 UTSW 8 15906071 missense probably damaging 0.99
R3780:Csmd1 UTSW 8 16201986 missense probably damaging 1.00
R3815:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3816:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3818:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3819:Csmd1 UTSW 8 16002522 missense probably damaging 1.00
R3850:Csmd1 UTSW 8 16079922 missense probably benign 0.00
R3945:Csmd1 UTSW 8 15910619 intron probably null
R3980:Csmd1 UTSW 8 15906056 nonsense probably null
R4061:Csmd1 UTSW 8 15945158 missense probably benign 0.00
R4086:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4087:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4089:Csmd1 UTSW 8 15992738 missense probably damaging 0.99
R4183:Csmd1 UTSW 8 15910464 missense probably damaging 0.99
R4226:Csmd1 UTSW 8 16000490 missense probably damaging 0.99
R4454:Csmd1 UTSW 8 15945011 missense probably damaging 0.99
R4533:Csmd1 UTSW 8 15931037 splice site probably null
R4544:Csmd1 UTSW 8 16710636 missense possibly damaging 0.93
R4547:Csmd1 UTSW 8 16391797 missense possibly damaging 0.48
R4612:Csmd1 UTSW 8 15921908 splice site probably null
R4620:Csmd1 UTSW 8 16002694 critical splice acceptor site probably null
R4627:Csmd1 UTSW 8 16697917 missense probably benign 0.00
R4633:Csmd1 UTSW 8 16002620 missense probably damaging 0.99
R4646:Csmd1 UTSW 8 15932511 missense possibly damaging 0.87
R4648:Csmd1 UTSW 8 15998788 nonsense probably null
R4668:Csmd1 UTSW 8 16023891 missense possibly damaging 0.50
R4709:Csmd1 UTSW 8 16023891 missense possibly damaging 0.96
R4709:Csmd1 UTSW 8 16710506 critical splice donor site probably null
R4741:Csmd1 UTSW 8 15910447 missense probably damaging 0.99
R4774:Csmd1 UTSW 8 16009369 missense probably benign 0.11
R4793:Csmd1 UTSW 8 16088263 missense probably damaging 1.00
R4829:Csmd1 UTSW 8 16127296 missense probably damaging 1.00
R4888:Csmd1 UTSW 8 15895674 utr 3 prime probably benign
R4896:Csmd1 UTSW 8 16009439 missense probably benign 0.00
R4932:Csmd1 UTSW 8 16023765 missense probably damaging 0.99
R4944:Csmd1 UTSW 8 15998772 missense probably damaging 1.00
R4953:Csmd1 UTSW 8 16199917 missense probably damaging 0.99
R4996:Csmd1 UTSW 8 15910452 missense probably damaging 0.97
R5028:Csmd1 UTSW 8 15989090 missense probably damaging 1.00
R5146:Csmd1 UTSW 8 16196190 missense probably damaging 1.00
R5272:Csmd1 UTSW 8 16199944 missense probably damaging 0.99
R5327:Csmd1 UTSW 8 17216712 missense possibly damaging 0.94
R5399:Csmd1 UTSW 8 16710597 missense probably damaging 1.00
R5411:Csmd1 UTSW 8 15910471 missense probably damaging 1.00
R5462:Csmd1 UTSW 8 15961486 missense probably benign 0.12
R5463:Csmd1 UTSW 8 15984860 missense probably benign 0.34
R5497:Csmd1 UTSW 8 16085181 missense probably benign 0.20
R5536:Csmd1 UTSW 8 16288660 missense probably damaging 0.99
R5711:Csmd1 UTSW 8 15953703 missense probably damaging 1.00
R5730:Csmd1 UTSW 8 16185192 nonsense probably null
R5788:Csmd1 UTSW 8 16201966 missense probably damaging 1.00
R5941:Csmd1 UTSW 8 15932471 missense probably damaging 0.99
R5960:Csmd1 UTSW 8 16071416 missense possibly damaging 0.68
R5961:Csmd1 UTSW 8 16070352 missense probably damaging 0.99
R5969:Csmd1 UTSW 8 16071353 missense probably benign 0.00
R5998:Csmd1 UTSW 8 15910443 missense probably damaging 1.00
R6062:Csmd1 UTSW 8 16092305 missense possibly damaging 0.68
R6109:Csmd1 UTSW 8 16199860 missense possibly damaging 0.93
R6116:Csmd1 UTSW 8 16211850 missense probably damaging 1.00
R6143:Csmd1 UTSW 8 16088301 missense probably damaging 1.00
R6155:Csmd1 UTSW 8 15903231 missense probably benign 0.01
R6197:Csmd1 UTSW 8 15926611 missense probably benign 0.32
R6247:Csmd1 UTSW 8 16196235 missense possibly damaging 0.91
R6304:Csmd1 UTSW 8 16058674 missense probably damaging 1.00
R6317:Csmd1 UTSW 8 16710642 missense possibly damaging 0.89
R6318:Csmd1 UTSW 8 15903212 missense probably damaging 1.00
R6338:Csmd1 UTSW 8 15932492 missense possibly damaging 0.75
R6369:Csmd1 UTSW 8 17535004 start gained probably benign
R6447:Csmd1 UTSW 8 15910527 missense probably damaging 1.00
R6454:Csmd1 UTSW 8 15921150 missense probably damaging 0.99
R6494:Csmd1 UTSW 8 16211695 splice site probably null
R6614:Csmd1 UTSW 8 17216787 missense probably damaging 1.00
R6736:Csmd1 UTSW 8 16002626 missense probably damaging 0.99
R6769:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6771:Csmd1 UTSW 8 16071394 missense possibly damaging 0.80
R6804:Csmd1 UTSW 8 16037246 missense probably damaging 1.00
R6818:Csmd1 UTSW 8 16185327 missense probably damaging 1.00
R6863:Csmd1 UTSW 8 17534913 missense possibly damaging 0.85
R6930:Csmd1 UTSW 8 16092395 missense probably damaging 0.97
R6969:Csmd1 UTSW 8 17216789 missense possibly damaging 0.94
X0011:Csmd1 UTSW 8 16196263 missense probably damaging 1.00
X0021:Csmd1 UTSW 8 16185256 missense probably damaging 1.00
X0024:Csmd1 UTSW 8 16037218 missense probably damaging 0.99
X0028:Csmd1 UTSW 8 15915333 missense possibly damaging 0.79
Z1088:Csmd1 UTSW 8 15921875 missense possibly damaging 0.91
Z1088:Csmd1 UTSW 8 16092258 missense probably damaging 1.00
Z1088:Csmd1 UTSW 8 16189978 missense possibly damaging 0.50
Z1088:Csmd1 UTSW 8 16200058 missense probably damaging 0.97
Z1088:Csmd1 UTSW 8 16346617 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTGACTCAGACGGGGAAACAC -3'
(R):5'- GGGCTGCCAGTAAGTTAGGAAACC -3'

Sequencing Primer
(F):5'- CACATTGCAACGATGACTGAATTAC -3'
(R):5'- GAAAATCCCGTCAGTTGTGC -3'
Posted On2013-06-11